I. Úvod do klonování a genového inženýrství

Komentáře

Transkript

I. Úvod do klonování a genového inženýrství
•15/03/2010
KLONOVÁNÍ a GENOVÉ
INŽENÝRSTVÍ
KLONOVÁNÍ a GENOVÉ
INŽENÝRSTVÍ
1) úvodní přednáška
2) PCR techniky
3) mutageneze in vitro
4) cDNA a genomové knihovny
5) sekvencování genomů
6) transgenoze rostlin
7) genové čipy
8) transgenoze živočichů
9) genová terapie
10) klonovací strategie a expresní systémy
11) seminář – nástroje molekulární biologie v praxi
•1
•15/03/2010
Získávání bioinformací
(dobrovolný seminář)
•
•
•
•
•
•
NCBI (National Center for Biological Information)
TIGR (The Institute for Genomic Research)
SignalP, TargetP (predikce buněčné lokalizace proteinů)
BIOEDIT (freeware pro manipulaci s DNA a proteiny)
BLAST (basic local alighment and search tool)
GENEVESTIGATOR (sledování exprese genů na úrovni
celých genomů in silico)
LITERATURA
Glick R a Pasternak JJ
Molecular Biotechnology
3th edition, ASM Press Ltd, Washington, USA, 2003
Sambrook J a kol.
Molecular Cloning 1,2,3
3th edition, Cold Spring Harbor Laboratory Press, New York, USA 2001
Rosypal S
Úvod do Molekulární Biologie díl čtvrtý
třetí vydání, Prof.RNDr. Stanislav Rosypal, DrSc, Brno 2002
Brown TA; překlad Fellner M a kol.
Klonování genů a analýza DNA
1 české vydání, Olomouc UP 2007
http://biologie.upol.cz/metody/
•2
•15/03/2010
Centralní
Central
ní dogma
DNA
RNA
Protein
Fenotyp
DNA do DNA Æ REPLI
REPLIKACE
KACE
DNA do RNA Æ TRANS
TRANSKRIPCE
KRIPCE
RNA do Protein Æ TRANSLAC
TRANSLACE
E
RNA do DNA
Æ
REVERZNÍ
REVER
ZNÍ TRANS
TRANSKRIPCE
KRIPCE
Jeden gen jeden enzym (protein/polypeptid)
Centralní
Central
ní dogma
Gen 9,200 bp
5’
3’
AAGCTCGACTAGCGCTAGCCTACCTAGCTCTCCCCTTCC
5’
zralá RNA 1,870 bp
AAA 3’
(kodující sekvence ORF (open reading frame) a nepřekládané regiony – 5´-UTR, 3´-UTR)
Protein 386 aa
N
C
CDS 1158 bp
(coding sequence)
•3
•15/03/2010
Struktura
Struktur
a genu
•
•
•
•
•
•
Introny a Exony
Promotor
Enhancer a Silencer
Počátek transkripce
Transkripční faktory
Signální sekvence
Introny a Exon
Introny
Exony
y: Kodující sekvence (ORF) mnoha eukaryotických genů je
přerušená sekvencí známou jako introny. Introny jsou úseky DNA jejichž
transkripty nejsou přítomný ve zralé mRNA. Exony jsou části sekvence
přítomné ve zralé mRNA a kodují produkt eukaryotického genu.
Místo počátku transkripce: místo kde začíná syntéza mRNA (pozice 0, 30bp od TATA boxu) .
Promotor: Oblast genu (5’-konec) upstream od místa počátku transkripce
sloužící jako templát pro navázání transkripční jednotky a iniciaci
transkripce. Inducibilní promotor – je závislý na přítomnosti induktoru
(nízkomolekulární látka). Konstitutivní promotor – nezávislý (provozní
„house
h
k
keeping“
i “ geny).
)
Enhancer: Část sekvence genu která interaguje s transkripčními faktory a
tak zvyšuje účinnost transkripce. Je umístěna upstream nebo downstream
od kódující sekvence a může být stovky bází daleko od kódující sekvence
kterou kontroluje.
Silencer: Opak enhanceru.
p
faktory:
y Proteinyy interagující
g j se specifickou
p
sekvenci DNA,,
Transkripční
většinou ovlivňující terciální strukturu DNA a tak regulují transkripční
jednotku. Jsou buď aktivátory nebo represory viz výše.
Koaktivátory: Proteiny interagující s transkripčními faktory (ale ne s DNA)
regulující transkripci.
Signální sekvence: kóduje signální peptid, který předurčuje zacílení
proteinu na buněčné úrovni a následně se odštěpuje.
•4
•15/03/2010
DNA Æ DNA
DNA polymerasy
blíže přednáška techniky PCR
DNA Æ RNA
Transkripce (RNA syntéza): přenos informace z DNA do RNA
(nestabilní) prostřednictvím enzymu RNA Polymerasy (DNA-dependentní
RNA Polymerasa).
Syntéza RNA je komplementární k templátovému DNA duplexu a je
identická s netemplátovým vláknem duplexu (5´-3´). Netemplátový
řetězec je proto nazýván kódující řetězec a je identický s mRNA s
výjimkou záměny U za T.
Typy RNA:
RNA:
messenger RNA (mRNA, polyA+ RNA). RNA která je přepisována do
polypeptidů (1-5%).
ribozomální RNA (rRNA). strukturní složka ribozómů. (90
90%
%)
transferová RNA (tRNA). přenašeč aminokyselin do místa syntézy
proteinu. (5-10
10%
%)
málá jaderná, jadérková, cytoplazmatická RNA (snRNA/sno/scRNA).
sestřih mRNA
•5
•15/03/2010
Postranskripční úpravy mRNA
• Čepička (capping). modifikovaný guanozin (m7G) je
přidáván na 5'-konec většiny mRNA. Stabilita mRNA a
podílí se na vazbě k ribozomu.
• P
Polyadenylace.
l d
l
100 200
100-200
b
bp
dl há
dlouhá
sekvence
k
polyadenozinu je přidávána na 3'-konec většiny
eukaryotické pre-mRNA. PolyA konec není kodován v
DNA.
• Sestřih intronů a exonů. introny jsou vyštěpeny a exony
spojeny dohromady ve struktuře zvané spliceozom.
Y pyrimidinová báze
Postranskripční úpravy mRNA
•6
•15/03/2010
RNA Æ protein
• Translace (syntéza proteinů): Translace je proces přeměny informace z RNA
do aminokyselinového řetězce (polypeptidu) probíhající v cytoplasmě. Zralá
mRNA je transportována do cytoplasmy k ribozomům (mnohdy vázané na
endoplasmatickou retikulární síť).
proteinů které tvoří
• Ribozóm se skládá ze strukturní rRNA a 80 různých proteinů,
malou a velkou podjednotku.
• Iniciace: Zachycení mRNA a nalezení start kodonu AUG, který koduje
methionin.
(M je odštěpen během postranslačních úprav nebo společně se signálním
peptidem)
• Elongace: Přidávání různých AK v aktivované formě vázané na tRNA a
vytváření peptidové vazby mezi amino a karboxylovou skupinou.
• Terminace: STOP kodón (UAA, UAG nebo UGA)
Posttranslační úpravy:
• Fosforylace, glykosylace, organelové cílení a odštěpení
signálního peptidu, složení do aktivního stavu
(vytvoření terciální a kvartérní struktury).
RNA Æ DNA
Reverzní transkripce: Proces vytvoření DNA z RNA templátu za
pomocí RNA-dependentní DNA polymerasy – Rever
Reverzní
zní
trans
ransk
kriptasa
riptasa (RT).
RT je přítomná pouze v RNA virech avian myeloblastosis virus
(AMV
AMV), Moloney murine leukemia virus (MMLV
MMLV), nebo human
immunodeficiency virus (HIV).
Aplikace
Apli
kace::
tvorba cDNA (komplementární DNA): přesná DNA kopie mRNA.
mRNA
DNA sekvence proteinu bez přerušení introny.
• cDNA knihovny
• RT PCR
•7
•15/03/2010
PG2
Hybridizace
• Dva řetězce DNA mohou být k sobě komplementární.
• mRNA syntetizována z genu je identická k jednomu vláknu svého
genu a komplementární k druhému vláknu.
• Komplementární
p
řetězce mohou být
ý oddělenyy ((denaturace)) a znovu
spojeny (renaturace – hybridizace) na různém stupni specifity,
mohou vznikat hybridní formace DNA-DNA, DNA-RNA, nebo RNARNA.
Methody využívající těchto vlastnosti:
Methody
vlastnosti:
• Southern blot: Hybridizace DNA na DNA (v pevné fázi)
• Northern blot: Hybridizace DNA na RNA (v pevné fázi)
• RNAse protection assay: Hybridizace RNA na RNA (v roztoku)
• In situ hybridizace DNA-DNA nebo DNA-RNA (ve tkání, či v buňce,
např. FISH)
• izolace mRNA: vazba polyA konce na polyT sekvenci navázanou na
pevný matrix.
Stringence: podmínky zaručující stupeň specifity (komplementarity)
PG1
Strigence hybridizace
teplota
▲
koncentrace soli ▼
Denaturační činidla (formamid) za
snížené teploty udržují vysokou strigenci
•8
Snímek 15
PG2
RNAse protection assay multi Northern blot ve zkumavce: pripravi se in vitro transcrpipcí proby proti
cilové mRNA, necha se probehnout hybridizace, vsechny ssRNA se pak rozstipou, reakce se hodí na
gel a sleduje se intenzita (pomocí značení sondy) a velikost získaných bandu.
galuszka; 18/02/2008
Snímek 16
PG1
foramid narušuje vodíkové vazby mezi bázemi a tím snižuje melting temperature, muze byt nahrazen
mene toxickou močovinou
galuszka; 18/02/2008
•15/03/2010
PG3
Princip Southern a Northern blotu
Hybridizační sondy jsou značené:
•
•
•
•
•
•
•
•
•
chemiluminiscenčně BIOTIN detekce AVIDIN-HRP, DIGOXYGENIN
fluorescenčně FLUORESCEIN, RHODAMIN
radioaktivně dAT32P, 3H
Příprava sond:
5´ a 3´koncové značení – nízká citlivost
pomocí RANDOM HEXAMERů a DNA polymerasy (Klenowův fragment)
PCR
nick translace – DNasa I a DNA polymerasa
FISH fluorescent in situ hybridization
in vitro transkripce (RNA próby)
příklad nukleotidu značeného
digoxygeninem
•9
Snímek 17
PG3
rozdělit typy sond RNA a DNA
galuszka; 18/02/2008
•15/03/2010
PG1
PG4
Příprava hybridizačních sond
značení pomocí náhodných hexameru
značení pomocí nick translation
(posun jednořetězcového zlomu)
RESTRIKČNÍ ENDONUKLEASY
(restrikční enzymy II třídy)
•
rozpoznávají specifické sekvence
dsDNA a štípou jí ve stejném místě
•
rozpoznávací místo je 4-8 bp dlouhé
•
štípou dlouhé fragmenty dsDNA na
kratší
•
štípou vždy znovu opakovatelným
způsobem
•
pocházejí především z bakterií
•
ochrana před cizorodou DNA
především bakteriofágovou
•
modifikačně-restrikční enzymový
y
ý
systém (RE + specifická modifikační
metylasa)
•
Přes 120 rozpoznávacích míst
•
dodnes popsaných více než 800 RE
•10
Snímek 19
PG4
Klenowuv fragment: postráda 5-3 exonukleasovou aktivitu, polymerasa nedegraduje jiz nasedly
primer a zastavuje se polymerizace
galuszka; 18/02/2008
PG1
Labeling principle The nick translation method (1) is based on the ability
of DNase I to introduce randomly distributed nicks into
DNA at low enzyme concentrations in the presence of
Mg2+.
E. coli DNA polymerase I synthesizes DNA complementary
to the intact strand in a 5' → 3' direction using
the 3'-OH termini of the nick as a primer (2). The 5' → 3'
exonucleolytic activity of DNA polymerase I simultaneously
removes nucleotides in the direction of synthesis
(3). The polymerase activity sequentially replaces
the removed nucleotides with isotope-labeled or haptenlabeled deoxyribonucleoside triphosphates (1). At
low temperature (15°C), the unlabeled DNA in the
reaction is thus replaced by newly synthesized labeled
DNA.
DNA The DNA must be in low-salt concentration solution.
Radioactive dNTP
for labeling
[α-32P] dCTP is preferentially used due to its greater
stability in comparison to other labeled deoxyribonucleoside
triphosphates.
[α-32P] deoxyribonucleoside triphosphates with a specific
activity of 3000 Ci/mmol give better incorporation
and higher levels of labeling than those with a specific
activity of 400 Ci/mmol under identical reaction conditions.
Specific activity The level of specific labeling and the incorporation rate
are dependent on the ratio of substrate DNA to labeled
Petr Galuszka; 11/02/2006
•15/03/2010
RESTRIKČNÍ MíSTA MAJÍ BOD SYMETRIE
• RE mohou na DNA vytvářet TUPÉ
nebo LEPIVÉ konce
• restrikční sekvence jsou většinou
y
symetrické.
• nukleotidy vytvářejí PALINDROM
• Palindrom: sekvence se čte stejně v
obou směrech jak ve
5’ → 3’ tak ve směru 5’ → 3’ na
komplementárním řetězci.
EcoRI
TUPÉ KONCE – nespecifické spojení
LEPiVÉ KONCE –
specifické spojení
Existují RE se stejnou restrikční sekvencí lišící se pouze typem vzniklých konců (5´- či
3´- lepivé) KpnI vs. Asp718 - izoschizomery
Lepivé konce:
konce:
každý DNA fragment (jakéhokoli původu) tvoří štěpením stejnou RE dvě jednovláknové identické
sekvence (čtené ve směru 5’ - 3’).
Kompatibilní konce
konce::
BamHI
GˇGATCC
BglII
AˇGATCT
•11
•15/03/2010
• dvě odlišné DNA mající stejné rozpoznávací místo pro danou RE se
mohou vzájemně spojit v rekombinantní DNA molekulu
• rek
rekombinant
ombinantní
ní DNA molekula
molekula:: je nová kombinace nukleotidů v DNA
která se nevyskytuje volně v přírodě
Počet nukleotidů v restrikčním místě dané RE determinuje průměrnou
délku fragmentů DNA získaných naštípaním danou RE
Pravděpodobnost že dané restrikční místo bude nalezeno v genomu:
1) 44 = 256 bp
2) 46 = 4096 bp
3)) 48 = 64 000 bp
p
průměrná vzdálenost mezi
restrikčními sekvencemi v DNA
= 4n
n = # bází v restrikčním místě
GTAC
Působení RE jje velmi citlivé na
iontovou sílu roztoku a charakter
přítomných solí.
Pokud nejsou zachovány specifické
podmínky pro danou RE ta může
mít tzv. star aktivitu
STAR AKTIVITA – nespecifické
náhodné štěpení
•12
•15/03/2010
T4 DNA ligasa
•
•
•
•
•
enzym izolovaný z T4 bakteriofága infikujícího E.coli,
katalyzuje tvorbu fosfodiesterové vazby mezi
5´fosfátovou skupinou jednoho a 3´OH skupinou
sousedního nukleotidu.
reakce vyžaduje energii jednoho ATP
používá se ke spojování lepivých i tupých konců
dvou restrikčních fragmentů DNA, připojování
různých adaptorových sekvencí k DNA a cirkulizaci
DNA
Reakce se provádí většinou za snížené teploty (1516°C) aby se snížila kinetická energie molekul a
zabránilo se tak nekomplementárnímu spárování
lepivých konců.
zápor: nízká aktivita enzymu – dlouhý reakční čas.
Další enzymy používané v molekulární biologii:
Alkalická fosfatasa
Mung Bean nukleasa
KLONOVÁNÍ
Molekulární klonování:
klonování:
• multi-krokový proces který vytvoří kolekci definovaných fragmentů dané DNA
pomocí restrikčních endonukleas
• spojení
j í vybraných
b
ý h DNA ffragmentů
tů ((většinou
ětši
jjednoho
d h genu)) se speciálním
iál í
nosičem – vektor pomocí T4 DNA ligasy
• přenos vzniklého konstruktu do živých buněk (často baktérie)
• mnohonásobné namnožení vložených DNA fragmentů replikaci v živé buňce –
DNA KLONY
Buněčné klonování:
klonování:
• vytváření geneticky identických buněk (organismů)
• v živé přírodě přirozené: kolonie baktérii
řízkování rostlin
jednovaječná dvojčata
umělé ►
•13
•15/03/2010
KLONOVACÍ VEKTORY
A)
Bakteriální a kvasinkové – PLASMIDY
-
přirozené součástí bakteriálních buněk nesoucí vlastní genetickou informaci ve formě
dsDNA (rezistence k antibiotikům, metabolismus nezvyklých substrátů…) 1-100kb
replikují se nezávisle na baktérii
vlastní plasmidové vektory vznikly úpravou přirozených
„high copy“ plasmidy
-
1970 - pBR (Bolivar a Rodriguez)
- 4.36 kb menší než je přirozeně se vyskytující v E.coli
- ori vlastní počátek replikace
- rezistence k Amp a Tc
- unikátní restrikční místa
- kapacita pro inzertovou DNA 1-5 kb
100-1000 kopií v buńce
MCS
multiple cloning site
ori
(polylinker)
KLONOVACÍ VEKTORY
B)
Virové - BAKTERIOFÁGY
-
bakteriální viry s dvouřetězcovou lineární DNA
klonovací kapacita 2-25kb inzertu
-
mnohonásobné množení v závislosti na hostitelské bakterii
cos
cos
BAKTERIOFÁG lambda
49kb
•
Střední část genomu není důležitá pro
lytický růst a lze ji nahradit inzertovou
DNA
•
snadná manipulace díky cos místům
(lepivé konce) na koncích λ DNA, které
umožňují její cirkulaci
•
Zacirkuluje se pouze bakteriofág, který
má vzdálenost mezi cos místy 37-52kb
•
tvorba cDNA a genomových knihoven
•14
•15/03/2010
PG5
KLONOVACÍ VEKTORY
C) bakteriálně-virové - KOSMIDY
•
•
•
•
odvozené z plasmidu do kterého byly naklonovány cos místa bakteriofága λ
Inzertová DNA je naklonována do lineárního kosmidu a sbalena in vitro
virovým mechanismem a infikována do bakterie
v bakterii je pak cirkulována a replikuje se dál jako plasmid
malá velikost cca 5kb – není potřeba infekčních lytických λ proteinů, pouze
selekční marker k antibiotiku, velikost inzertové DNA se může pohybovat až
k 47
47kb
kb
D) bakteriálně-virové - FASMIDY (phagemid)
•
•
•
odvozené od bakteriofága M13 s malou ssDNA (6.4kb), který se po infekci do
bakterie replikuje jako kruhovitá dsDNA (plasmid, snadná manipulace, restrikce)
infekční fágové částice však opět obsahují pouze ssDNA (vhodný zdroj pro
izolaci ssDNA např. pro hybridizaci)
do infekčních částic mohou být sbaleny částice až dvakrát větší než je fágová
DNA
•15
Snímek 29
PG5
KOSMIDY nemají lytické geny, replikují se jako bakteriofág ale nelýzují bakterii, s prazdnýma se
manipuluje jako s plasmidy.
Replikuji se pomaleji než plasmidy
KONKATEMERY - cirkularní kosmid se naštípe jedním lepivým a jedním tupym aby nedochazelo k
cirkulaci
galuszka; 18/02/2008
•15/03/2010
KLONOVACÍ VEKTORY
E) kvasinkové - YAC umělé kvasinkové chromosomy
(yeast artificial chromosomes)
•patří mezi kyvadlové vektory (shuttle vector)
•v bakterii jako kruhová dsDNA (plasmid)
•vedle sekvencí bakteriálního plasmidu obsahují části
kvasinkového chromozomu ((centromera,, počátek
p
replikace,dvě telomery)
•linearizací se chromozom aktivuje (oddělení telomer od
sebe)
•obrovská klonovací kapacita až 2000kb
•nestabilita a složitá manipulace (protoplasty)
KYVADLOVÉ VEKTORY umožňující existenci a replikaci ve dvou rozdílných organismech:
pYES bakterie – kvasinka - počátek replikace z přirozeného kvasinkového vektoru 2μ
Ti-plazmid bakterie – rostlina viz přednáška transgenoze rostlin
KLONOVACÍ VEKTORY
F) bakteriální - BAC umělé bakteriální chromosomy
(bacterial artificial chromosomes)
Odvozené od E.coli F-plasmidu (fertility plasmid), „low copy“ 1-2 kopie na buńku
VÝHODY oproti
ti YAC:
YAC
- stabilita (cirkulární)
- snadná manipulace
- potlačení rekombinace
Vhodné fragmenty genomické DNA pro ligaci
jsou získány pulsní gelovou elektroforesou
INVITROGEN
VELKÝ VÝZNAM PŔI MANIPULACI S CELÝMI GENOMY
•16
•15/03/2010
Obecný princip molekulárního
klonování
klonovací vector + DNA obsahující
požadovaný gen (izolace)
restrikce
t ik
ligace
transformace
selekce pomocí selekčních markerů
reprodukce a syntéza cílového proteinu
izolace
Využití molekulárního klonování
• uchovávání, zmnožení a manipulace s genetickou informací (cDNA a genomové knihovny)
• produkce proteinů pro různorodé využití
• vnášení nových či pozměněných genů do organismů (GMO, genová terapie)
farmaceutika
zemědělství
základní výzkum
průmysl
medicína
•17
•15/03/2010
SELEKČNÍ MARKERY
geny nesené na klonovacím vektoru, exprimované
současně s transgenem, na jejichž fenotypovém
projevu lze transformované buňky snadno
selektovat
1) geny kódující degradaci ANTIBIOTIKA
•
INHIBITORY SYNTÉZY BAKTERIÁLNÍ BUNĚČNÉ STĚNY
AMPICILIN gen Amp koduje β-laktamasu která štěpí β-laktámový kruh penicilinových antibiotik
CEFOTAXIM
• INHIBITORY SYNTÉZY PROTEINů
CHLORAMFENIKOL,, KANAMYCIN
CHLORAMFENIKOL
(vážou se na ribozomální podjednotky)
gen Cml kóduje
g
j chloramfenikol acyltransferasu
y
gen Kan kóduje aminoglykosid fosfotransferasu
AMPICILIN
SELEKČNÍ MARKERY
1) geny kódující degradaci ANTIBIOTIKA
•
INHIBITORY SYNTÉZY PROTEINů
TETRACYKLIN (zabraňuje vazbě aminoacyl tRNA k ribozomu) gen Tet kóduje membránový
protein, který aktivně transportuje TC ven z buňky
HYGROMYCIN B (interferuje s velkou ribozomální podjednotkou a zabraňuje elongaci
syntetizovaného peptidu) gen způsobující rezistenci hgh kóduje fosforylasu inaktivující toto
antibiotikum. PůSOBÍ I NA EUKARYOTICKÉ BUŇKY!!! (selekce transgenních rostlin)
1
•
INHIBITORY TRANSKRIPCE A REPLIKACE
ACTINOMYCIN D (inhibuje transkripci tím, že se váže na specifické úseky DNA)
RIFAMPICIN (inhibuje prokaryotní RNA polymerasu, ale i chloroplastovou a mitochondriální,
proto je toxicky i pro člověka)
ZEOCIN – glykopeptid izolovaný ze Streptomyces,
který štěpí po vstupu do buňky jakoukoliv DNA.
Rezistentní gen Sh ble kóduje inhibiční protein
(13.6 kDa) tohoto glykopeptidu.
koncentrace účinné pro selekci:
Baktérie
25-50 μg/mL
Kvasinky
50-300 μg/mL
Savčí buňky
50-1000 μg/mL
1
ZEOCIN
•18
•15/03/2010
SELEKČNÍ MARKERY
2) geny kódující enzymy narušující NUTRIČNÍ NEDOSTATEČNOST
(ztráta autotrofie)
- používají se především pro selekci transgenních kvasinek
•
Gen URA3 kóduje enzym orotidin 5´-fosfát dekarboxylasu, enzym metabolické dráhy uracilu
•
LYS2 kóduje aminoadipát reduktasu (bisyntéza lyzinu)
•
ADE2 (C1-tetrahydrofolát syntasa), LEU2 (β- izopropylmalát dehydrogenasa), TRP1
(fosforibozylanthranilát izomerasa)
Princip selekce: pro transformaci daného plasmidu se použijí
specifické kmeny kvasinek deficientní pro daný gen, selekce
se pak provádí na minimálním médiu (bez živin).
Příklad: kmen Saccharomyces cerevisiae INVSc1
genotyp: MATa his3Δ1 leu2 trp1-289 ura3-52
/MATλ his3Δ1 leu2 trp1-289 ura3-52
fenotyp: His-, Leu-, Trp-, Uratzn. že tento kmen je autotrofní na histidin, leucin,
tryptofan a uracil a na médiu bez těchto živin
neporoste
kyvadlový vektor pro transformaci kvasinek →
SELEKČNÍ MARKERY
3) blue/white screening test
-
pomocný test pro selekci transformovaných bakterií či bakteriofágu
klonovací vektor nese gen lacZ+ který kóduje enzym β-galaktosidasu (štěpí laktosu na
galaktosu a glukosu)
MCS je umístěn uvnitř tohoto genu, a po vložení inzertu se tento gen stává neaktivní
X-GAL
HOCH2
O
HO
H
O
Cl
O
Br
OH
galaktosa
N
H
modré barvivo
Ampicilin (zabije netransformované bakterie)
X-GAL (5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside)
umělý substrát
IPTG (isopropyl-1-thio-β-D-galaktopyranoside)
→
→
→
induktor exprese lacZ genu
•19
•15/03/2010
lytický a lysogenní cyklus virů
struktura lambda bakteriofága
•20
•15/03/2010
SELEKČNÍ MARKERY
4) lysogenní selekce bakteriofágových vektoru
LAMBDA FIX II VEKTOR (λ bakteriofágový
vektor)
-
selekce se provádí na speciálním kmeni
E.coli
E
coli (lysogenní pro P2 bakteriofága,
bakteriofága tzn.
tzn
že hostitelská buňka je již napadená jiným
bakteriofágem)
-
Pokud má λ vektor genotyp red/gam+ na
daném kmeni neroste je tzv. Sensitivní k
P2 interferenci (Spi+ fenotyp)
-
red a gam geny se nacházejí ve střední
části (stuffer) a jsou nahrazeny inzertem.
Bakteriofág
g s inzertem jje tudiž Spip
a
může být vyselektován na P2 lysogenním
kmeni
red/gam+
J
12 kb
I
red/gam-
příliš malý
nesbalí se
do kapsidy
inzert (genomová knihovna)
•21

Podobné dokumenty

geotechnické problémy líniových stavieb

geotechnické problémy líniových stavieb Rybak, J.: Akustické skúšky betónovaných CFA pilót v počiatočnom štádiu EARLY STAGE ACOUSTIC WAVE VELOCITY OF CONCRETE CFA PILES

Více

metabolismus proteinů

metabolismus proteinů Z biologického hlediska je potřebných všech 20 základních aminokyselin, které tvoří primární strukturu proteinů v organismu. Z tohoto počtu 8 si nedokážeme syntetizovat a musí být přijaty potravou;...

Více

Návod k použití

Návod k použití Návod k použití LPF 001

Více

Vybraná témata pro výuku chemie - Učitel chemie

Vybraná témata pro výuku chemie - Učitel chemie kovalentní vazby, k jejíž vazebné dvojici přispívají oba vázané atomy, každý jedním elektronem. Například koordinačně kovalentní vazba vznikající mezi vodíkovým kationtem a molekulou amoniaku při ...

Více

Buněčné kultury a produkce rekombinantních proteinů

Buněčné kultury a produkce rekombinantních proteinů plasmidy, kosmidy a bakteriofágy extrachromosomální elementy s autonomní replikací malá velikost – vysoká účinnost transformace, klonování velkých DNA fragmentů Klonovací vektory – umožňují snadné ...

Více

autotrofie buňkami single

autotrofie buňkami single are most often due to changes in protein structure. An alternative explanation is that the mutation destablizes a stem-loop structure in the RNA which plays a role in regulation. (It is possible to...

Více

sylabus

sylabus než jednotlivé baze a jejich sekvence. RNP motiv proteinu – vazebná doména; evolučně konzervované sekvence AK. Postsyntetické (postranskripční) úpravy transkriptu: modifikace hnRNA, sestřih hnRNA, ...

Více

Od stavebních bloků k polymerům života

Od stavebních bloků k polymerům života Přesnost kopírování musí být lepší než 1/délka sekvence, sekvence, tj. pro 100100-mer 99%, pro 4040-mer 97,5% - takové ribozymi nejsou dosud známy… Pouze malá část variant RNA má katalytickou funkc...

Více