Anguillula dipsaci

Czech University of Life Sciences, Department of Plant Protection, Prague, Czech Republic
Figures, texts and tables used in this presentation are available on public web pages.
Presentation can be used just for education, not for commercial purpose.
•Digestive
organs
•Reproductiv
e organs
•Excretory
structures
•Muscles
•Nerves
•Tough skin
or “Cuticle”
1.
2.
3.
4.
5.
6.
7.
Most numerous animal
Second most numerous species
Size: mostly microscopic
Simple morphology
No circulatory system
No respiratory system
No skeleton
Economic
important
microscopic
non
segmenting worms that live in different
environment and feed roots. Nematodes can
stunt the growth of the plants, and transmit
pathogens as a virus, bacteria or fungy.
Taxonomy of plant parasitic nematodes is rather complicated, many of
nematologists described thousands of nematodes species during last hundred
years. At the present time Siddigi 1986 is acceptable, with small number of
correction especially for small groups of plant parasitic nematodes.
Plant nematodes have both common and scientific names, some of
economical importance, by common name, are: Root-knot, Sting, Stubby-root,
Reniform, Lance, Ring, Lesion, Burrowing, Citrus, Spiral, and Cyst
Most of the Plant Parasitic Nematodes we can decide into two classes and
three orders. Most of plant parasitic nematode species belong to order
Tylenchida. Virus vector nematodes are situated in orders Dorylaimida and
Triplonchida.
Order 1
Order 2
Order 3
Basic morphology and anatomy
The nematode body is cover by cuticle which contain several layers depend
on stage. The cuticle is the flexible coating around the nematode [its skin],
which protects the nematode from physical and chemical dangers. The most
noticeable feature of the cuticle is the system of grooves across the body from
head to tail. As nematodes grow they usually shed their cuticle four times.
The stylet is a hard, sharp spear used for feeding. Muscles move the stylet
in and out and allow the nematode to puncture plant cells. Stylet (spear)
penetrate cells inject coctail of enzymes and withdraw the contents of the
cell. Form of the stylet is the important diagnostic criterion.
The esophagus is a tube where food moves from the
head to the intestine/stomach. Glands empty their
contents into the esophagus to help digestion.
The median bulb is a circular muscle which pumps
food through the esophagus. In the center of the
median bulb is a valve which only allows contents to
move from the stylet to the intestine.
The largest glands in nematodes are the esophageal
glands. These glands are made of large cells with large
nuclei and are thought to release substances which
help with digestion and feeding.
Nematode digestive systems are
made of a tube of a single layer of
cells - the intestine. Food enters the
intestine from the esophagus,
nutrients are absorbed, and wastes
are released through the anus.
Excretory System
Simple tubular system - in one or both lateral hypodermal chords in
Secernentea; embedded between the three cell bodies in hypodermal chord.
Individual excretory cells or tubular system in Adenophorea.
Excretory pore (external opening of tubular excretory systems) usually visible
due to cuticular lining - ventral, position is diagnostic.
Reproduction
Most nematode species produce males and females, but some species only
produce females. The ovary is where germ cells give rise to eggs. Fertilization,
by the sperm, takes place in the uterus and eggs are released through the
vagina. Even though the size of nematodes varies greatly, most nematode eggs
are about the same size and shape.
Male nematodes produce sperm in the testes which are shaped similar to the female
ovary. Sperm accumulate in the seminal vesicle and exit through the anus. During
mating rigid spicules insert into the vagina and form a passageway for the sperm.
Some males have thin cuticle extensions on both sides of the anus called bursae
copulatrix.
Spiule form is the most important diagnostic criterion.
Neural system
The nerve ring is the largest group of nerve cells in nematodes. Six bundles of nerve cells
extend from the nerve ring to sensory receptors in the nematode head. Other nerve cells
extend from the nerve ring towards the tail. In Plant parasitic group of nematodes s
usually visible just nerval ring.
Nematodes have a variety of sensilla:
(i) Amphids
open on or below lips (position of opening is diagnostic).
pouch with sensory neuron.
opening is a pore, slit, spiral, etc.
seem to contain mucoid material.
probably function a chemoreceptor's.
(ii) Phasmids
posterior location in lateral field - (chemoreceptors).
occur in Secernentea but not Adenophorea.
scutella are enlarged phasmids in some genera of
Tylenchida (e.g., Scutellonema).
(iii) Other Sensilla
have a fairly consistent structure; they include:
elongate setae
sensory pegs
shallow pits
deeper pits (e.g., amphids)
cephalic papillae - on lips - (tactile function?)
cephalic setae - more elongate
somatic setae - rare in Secernentea, but occur in
Adenophorea
deirids - in lateral field near nerve ring
(chemoreceptor's?)
Nematodes may be grouped by
feeding habit as:
•Endoparasitic– entire body
inside the root
•Ectoparasitic– entire body
outside the root
•Semi-endoparasitic- part of
body inside root
By movement when feeding, they
are called:
•Sedentary – mostly immobile
during their life
•Migratory – mobile for all their
life.
Frequent life cycle (example on Heteroderidae family)
Sampling representative
Plant material
soil samples
Extraction methods
Imobile stages (sedentery nematodes)
cysts in the soil
Mobile stages (free living nematodes)
females in
the roots
Flotation methods
Strip paper method
Fenvick can
Thomas can
Oostenbrick elutriator
Navlhčit a
vložit papír
Vzorek
půdy
Zalít vodou
Přidat detergent
Krátce zamíchat
Nechat 5 min stát
Baerman funel
Umělohmotné sítko
Skleněná nálevka
Silikonová hadice
tlačka
ED miska
Sieving method
Symptomatic methods use in nematology
Light microscopy
Electron microscopy
Immunochemical methods
Molecular biology methods
Symptomatic methods use in nematology
bulb scab
circular focus of the infection
knoting and swelling
forest dieback
dwarfism
sweling
necrosis
Light microscopy
Nativ slides x fixed slides
fixed nematodes
Measurement of nematodes L – body lenght
a – ratio of body lenght (L):
width of body
b – L: distance of mouth from intestine and
oesophaus conection
c – L: tail lenght
Měření háďátek
V=
distance between moth and vulva
L
x 100
:
Měření háďátek
T=
distance between anteriar intestine part and cloaca
L
x 100
:
Electron microscopy
Immunochemical methods
Molecular biology methods
PCR
RAPD
RFLP
SSCP
SCAR
AFLP
RTPCR
DBH
real
time
PCR
Plant protection against to nematodes
•Observance of the rules of Quarantine status
•Clean tools and equipment when changing areas or fields
•Crop rotation
•Chemical treatments nematicides
•Nematode-free (certified) seeds and planting material
•Tolerant or resistant cultivars (GMO?)
•Soil solarization
•Biofumigation
•Biological control
•Plant extracts application
•Ozone irrigation
The interactions of many soil organisms results in biological buffering or
regulation of the nematode population through the mechanisms of Exploitation,
Competition, and Antibiosis. This mechanisms can be use for nematode
regulation.
Nematode antagonist FUNGY nad batteries.
Arthrobotrys botryospora, Arthrobotrys superba, Dactylaria psychrophila,
Dactylaria candida, Dactylaria lysipaga, Dactylella sp., Arthrobotrytis sp,
Catenaria auxiliaris, Nematophthora gynophila.
Bacteries
Egg parsites
Application of plant extracts and essences
Azadirachta indiga
Globodera rostochiensis
Globodera pallida
Oblast vulvy CBH
Interpretace výsledků
Protilátka Mab 1rp je schopna konjugovat
s antigenem získaným z Ro i Pa. Naproti
tomu protilátka Mab 2p reaguje pouze s
antigenem získaným z Pa.
kontrola
Mab 1rp
Globodera pallida
Mab 2p
Mab 1rp
Globodera rostochiensis
Mab 2p
Multiplex PCR rozlišení Ro, Pa
M - molekulární marker
1 - DNA extrahovaná z Pa1
2 - DNA extrahovaná z Pa2
3 - DNA extrahovaná z Pa3
4 - DNA extrahovaná ze směsné
populace Ro a Pa
5 - DNA extrahovaná z Ro1
6 - DNA extrahovaná z Ro2/3
7 - DNA extrahovaná z Ro4
8 - DNA extrahovaná z Ro5
M - molekulární marker
1, 3, 5, 7, 9 - DNA extrahovaná z Ro1
2, 4, 6, 8, 10 - DNA extrahovaná z Pa2
M - Molekulární marker
1 - 4 - DNA získaná vždy z jednoho embryonu Pa
Ditylenchus dipsaci
was described by (Kuhn, 1857) Filipjev, 1936 as a
Bulb and Stem Nematode
Taxonomic position
CLASS: SECERNENTEA
•SUBCLASS: DIPLOGASTERIA
•ORDER: TYLENCHIDA
•SUBORDER: TYLENCHINA
•SUPERFAMILY: TYLENCHOIDEA
•FAMILY:ANGUINIDAE
Common names: ENG: Stem nematode, stem and bulb eelworm, onion bloat
IT: Nematode
dello stelo e dei bulbi
Host races are morphologically indistinguishable with different host
preferences.
Synonyms
Anguillula dipsaci Kuhn, 1857
Anguillula dipsaci (Kuhn) Gerv. et. v. Ben., 1859
Tylenchus dipsaci (Kuhn) Bastian, 1865
Anguillula devastatrix Kuhn, 1868
Anguillula secale Nitschke, 1868
Anguillula putrefaciens Kuhn, 1877
Tylenchus havensteini Kuhn, 1881
Tylenchus hyacinthi Prillieux, 1881
Tylenchus alii Beijerinck, 1883
Tylenchus devastatrix Ritzema Bos, 1888
Ditylenchus phloxidis Kirianova, 1951
Ditylenchus fragariae Kirianova, 1951
Anguillula dipsaci var. dipsaci Steiner and Scott, 1935
Anguillula dipsaci var. communis Steiner and Scott, 1935
GEOGRAPHICAL DISTRIBUTION
D. dipsaci occurs locally in most temperate areas of the world (Europe and the Mediterranean
region, North and South America, northern and southern Africa, Asia and Oceania) but it does not
seem able to establish itself in tropical regions except at higher altitudes that have a temperate
climate. In most countries regulatory measures (e.g. certification schemes) are applied to
minimize further spread of D. dipsaci.
EPPO region: Albania, Algeria, Austria, Belarus, Belgium, Bulgaria, Croatia, Cyprus
(unconfirmed), Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary,
Iceland, Ireland, Israel, Italy, Latvia, Liechtenstein, Malta, Moldova, Morocco, Netherlands,
Norway, Poland, Portugal, Romania, Russia (European), Slovakia, Spain, Sweden, Switzerland,
Syria, Turkey, Tunisia, UK, Ukraine, Yugoslavia.
BIOLOGY
D. dipsaci is a migratory endoparasite that feeds upon parenchymatous tissue in stems
and bulbs, causing the breakdown of the middle lamellae of cell walls. Feeding often
causes swellings and distortion of aerial plant parts (stems, leaves, flowers) and necrosis
or rotting of stem bases, bulbs, tubers and rhizomes. During cold storage of bulbs and
tubers, D. dipsaci and rotting may continue to develop.
In onion plants at 15°C, the life-cycle takes about 20 days. Females lay 200 to 500 eggs
each. Fourth-stage juveniles tend to aggregate on or just below the surface of heavily
infested tissue to form clumps of "eelworm wool" and can survive in a dry condition for
several years; they may also become attached to the seeds of host plants (e.g. onions,
lucerne, Trifolium pratense, faba beans, Phlox drummondii). In clay soils, D. dipsaci
may persist for many years. Cool, moist conditions favour invasion of young plant tissue
by this nematode.
Over 450 hosts complicated by there being 8-10 host races or biotypes, some with
limited host range. Oat race: polyphagous, most grains, rye, corn, and oats. Alfalfa
race: rather specific, but alfalfa, many weeds, clovers. Bulb race: most bulbs,
daffodil, narcissus, and tulip. Other hosts include onion, garlic, carrots, peas,
potatoes, strawberry, sugarbeets; apples and peaches in nurseries; weeds.
DETECTION AND IDENTIFICATION
Symptoms
In general, this nematode causes swellings and distortion
of aerial plant parts and necrosis or rotting of stem bases,
bulbs, tubers and rhizomes.
Morphology
Slender transparent worms; adult about 1.2 mm long
head skeleton moderately developed, spear about 10-12 µm long with distinct basal knobs.
Female: 1.0-1.3 mm; a = 36-40; b = 6.5-7.1; c = 14-18; V = 80
tail terminus sharply pointed.
Post-vulval sac extending about half-way to the anus.
Male: 1.0-1.3 mm; a = 37-41; b = 6.5-7.3; c = 11-15; T = 65-72
Bursa rising opposite proximal ends of spicula and extending about threefourths the length of the tail.
Specific detection of D. dipsaci in tissue
18 S
ITS 1
5,8S
ITS 2
28 S
S21
S 18
900 bp
Fig. 1: Scheme of cistron rDNA and localization of used primersfor amplification of fragment between cistrons genes.
5 -AACGGCTCTGTTGGCTTCTAT-3 PF1
5 -ATTTACGACCCTGAGCCAGAT-3 PR1
5 -TCGCGAGAATCAATGAGTACC-3 PF2
5 -AATAGCCAGTCGATTCCGTCT-3 PR2
Fig. 4. Gel electrophoresis of the PCR
products obtained with primer pairs
PF1-PR1, using as template DNA
extracted from plant tissue artificially
infested with 15 individuals of D. dipsaci
(A), or healthy plant tissue (B). Lanes: 1
– garlic bulb, 2 – onion bulb, 3 – chicory
petiole, 4 – alfalfa stem, 5 – carrot bulb,
6 – positive control with genomic DNA of
D. dipsaci, 7 – negative control of sterile
distilled water, lanes M – MassRuler 100
bp DNA ladder (Fermentas, Lithuania)
Fig. 3. Agarose gel of the PCR
products using specific primer pairs
PF1-PR1 (A) and PF2-PR2 (B).
Lanes: 1,2 and 3 – D. dipsaci
(isolates from garlic, chicory and
alfalfa), 4 – G. pallida, 5 – B.
xylophilus, 6 – Rhabditis spp., 7 –
negative control of sterile distilled
water, M – MassRuler 100 bp DNA
ladder (Fermentas, Lithuania). A
fragment of 327 bp for PF1-PR1
primer pair and 396 bp for PF2-PR2
primer pair bp are observed with all
isolates of D. dipsaci, while no
fragment was amplified with other
nematodes
Analysis of ITS sequences of nuclear rDNA and development of a PCRbased assay for the rapid identification of the stem nematode Ditylenchus
dipsaci (Nematoda: Anguinidae) in plant tissues
M. Marek, M. Zouhar, P. RyŠánek, P. Havránek1
Fig. 5. Gel electrophoresis of the PCR
products obtained with primer pairs PF1-PR1
(A) and PF2-PR2 (B), using tenfold dilution
series of DNA template. Lanes: 1 to 6, 100 ng
to 1 pg of D. dipsaci genomic DNA, 7 –
negative control of sterile distilled water lanes
M – MassRuler 100 bp DNA ladder
(Fermentas,
Lithuania).
The
detection
threshold is observed to be 10 pg for PF1-PR1
primer pair and 100 pg for PF2-PR2 primer
pair
Department of Plant Protection, Czech University of Agriculture in
Prague, Kamýcká 129, 165 21 Prague 6,
E-mail: [email protected]; 1Kosmonautů 1029/9, 772 00
Olomouc, Czech Republic
Accepted for printing 2005
Meloidogyne sp. ROOT KNOT NEMATODE
Populace získané v zahraničí
Meloidogyne incognita
Meloidogyne hapla
Meloidogyne chitwoodi
Meloidogyne fallax
Meloidogyne arenaria
Meloidogyne javanica
Anglie (M. Philips)
Portugalsko (University of Evora)
Egypt
Skotsko (SCRI Dundee)
Košice (SAV)
Nizozemí (PRI Wageningen)
Nizozemí (PRI Wageningen)
Anglie (M. Philips)
Anglie (M. Philips)
Optimalizace metody PCR
1.
Diagnostika háďátka Meloidogyne incognita
Primery byly navrženy ze sekvence DNA kódující esophageal gland protein SEC-1 a byly
pojmenovány MIGF a MIGR.
Primery:
MIGF 5´- GGGCAAGTAAGGATGCTCTG –3´
%GC 55,00
MIGR 5´-GCACCTCTTTCATAGCCACG –3´
%GC 55,00
M – molekulární marker
1 – DNA extrahovaná C. Zijstrou
2 – DNA extrahovaná našimi
primery
M – molekulární marker
1 – DNA extrahovaná z 10 samiček
2 – DNA extrahovaná z konatminované půdy
M – molekulární marker
1 – DNA extrahovaná z M. incognita
2 – DNA extrahovaná z M. incognita
3 – DNA extrahovaná z M. javanica
4 – DNA extrahovaná z M. arenaria
5 – DNA extrahovaná z M. chitwoodi
6 – DNA extrahovaná z M. hapla
7 – DNA extrahovaná z M. fallax
M – molekulární marker
1 – DNA extrahovaná z jedné samičky
2 – DNA extrahovaná z kořenových hálek
3 – DNA extrahovaná z půdy
4 – DNA extrahovaná ze zárodečných vaků
2.
Diagnostika háďátek rodu Meloidogyne pomocí Multiplex PCR
Jako výchozí práce pro optimalizaci Multiplex PCR reakce byla použita publikace C. Zijlstra et
al., 1997. Reversní primer HCFI – 28S byl popsán Ferrisem et al., 1993.
Primery:
CF – ITS
5´- GAATTATACGCACAATT – 3´
H – 18S
5´- CTTGGAGACTGTTGATC -3´
I –ITS
5´- TGTAGGAGACTGTTGATG -3´
HCFI – 28S 5´- GCATATCAGTAAGCGGAGGAA -3´ (jako reverzní univerzální primer)
M – molekulární marker
1 – DNA extrahovaná z M. hapla
2 – DNA extrahovaná z M. fallax
3 – DNA extrahovaná z M. chitwoodi
4 – DNA extrahovaná z M. incognita
3.
Diagnostika háďátek M. hapla a M. chitwoodi
Byla optimalizována metoda pro odlišení M. hapla a M. chitwoodi.
Byly použity tyto primery:
MHOF 5´-CAGGCCCTTCCACCTAAAGA- 3´
MHIR 5´- CTTTCGTTGGGGAACTGAACA- 3´
MCIR 5´- CCAATGATAGAGATAGGCAC -3´
MC3F 5´- CTGGCTTCCTCTTGTCCAAA – 3´
M – molekulární marker
1 – DNA extrahovaná z M. chitwoodi
2 – DNA extrahovaná z M. hapla
http://mgd.nacse.org/hyperSQL/squiggles/songs.html