Analýza mutací genu COL1A1 českých pacientů s diagnózou

Komentáře

Transkript

Analýza mutací genu COL1A1 českých pacientů s diagnózou
cs30
Původní práce
Analýza mutací genu COL1A1 českých pacientů s diagnózou
osteogenesis imperfecta, typ I-IV
Lucie Šormová1 , Ivan Mazura1 , Ivo Mařík2
1
2
1. lékařská fakulta Univerzity Karlovy v Praze, ČR
Ambulantní centrum pro vady pohybového aparátu, Praha, ČR
Abstrakt
Přehled: Osteogenesis imperfecta je celosvětově rozšířené
onemocnění pojivové tkáně vyznačující se rozsáhlou klinickou heterogenitou. Hlavním klinickým příznakem je zvýšená fragilita kostí způsobená defektní produkcí kolagenu
typu I, který je kódován geny COL1A1 a COL1A2. Z klinického, radiologického a genetického hlediska rozlišujeme
11 forem onemocnění, přičemž pouze první čtyři typy vznikají v důsledku mutací genů kolagenu typ I. Závažnost onemocnění se pohybuje od lehkých forem po letální typy onemocnění.
Cíle a metody: Cílem studie je molekulárně-genetická analýza genu COL1A1 25 českých pacientů postižených onemocněním osteogenesis imperfecta, konkrétně I-IV typem,
a následné porovnání klinického obrazu jedinců se shodnými změnami DNA.
Výsledky: Mutace genu COL1A1 byly identifikovány
u 3 z 25 českých OI pacientů. Jedná se o nepříbuzné jedince
s diagnózou osteogenesis imperfecta typ IA, III a IVB.
Závěr: Identifikace mutačního spektra prostřednictvím
molekulárně genetických analýz dalších pacientů a jejich
příbuzných je nezbytná nejen pro stanovení vztahů mezi
genotypem a fenotypem postižených jedinců, ale zároveň
pro porovnání frekvence výskytu identifikovaných mutací
české populace s dalšími populacemi.
Klíčová slova
Osteogenesis imperfecta, kolagen typ I, COL1A1, COL1A2,
MLBR, mutace
Kontakt:
Lucie Šormová
1. lékařská fakulta, Univerzita Karlova v Praze
Adresa: Kateřinská 32, 121 08 Praha 2, ČR
E–mail: [email protected]
1
Úvod
Osteogenesis imperfecta je dědičné onemocnění pojivové tkáně, jehož charakteristickým klinickým znakem
jsou křehké kosti s vysokým rizikem pro vznik zlomenin. Dalšími klinickými rysy této choroby jsou podprůměrný až malý vzrůst, kloubní hypermobilita, hyperlaxicita kůže, modré skléry, nedoslýchavost a dentinogenesis
imperfecta. V některých případech jsou popisovány defekty plic či vaskulárního systému. Prvotní klasifikace, jejímž autorem byl David Sillence a která rozlišovala čtyři
typy OI, vznikla v roce 1979. V průběhu následujících
let byla tato klasifikace na základě identifikace nových
klinických, radiologických a genetických znaků postupně
rozšiřována o další typy až na současných 11 forem OI.
Molekulární podstatou prvních čtyř forem jsou mutace
genů kolagenu typ I (Collagen, type I, alpha-1 (COL1A1)
a Collagen, type I, alpha-2 (COL1A2)), původ zbývajících typů jsou mutace genů Serpin peptidase inhibitor,
EJBI – Ročník 8 (2012), číslo 5
EJBI 2012; 8(5):cs30–cs37
zasláno: 15. srpna 2012
přijato: 2. října 2012
publikováno: 22. listopadu 2012
clade F, member 1 (SerpinF1) (OI typ VI), genů 3-prolyl
hydroxylačního komplexu - Cartilage associated protein
(CRTAP), Leucine- and proline-enriched proteoglycan 1
(LEPRE1) a Peptidyl-prolyl isomerase 1 (Cyclophylin B)
(PPIB) (OI typ VII, VIII a IX), a defekty chaperonů Serpin peptidase inhibitor, clade H, member 1 (SerpinH1)
a FK506-binding protein 10 (FKBP10) (OI typ X a XI).
Etiologie pátého typu OI není v současnosti jasná [5, 18].
1.1
Kolagenní formy osteogenesis
imperfecta
OI typ I je nejmírnější formou OI s autozomálně dominantním typem dědičnosti. Riziko vzniku zlomenin je
zvýšené v období dětství a následně v postmenopauzálním období žen a po šedesátém roce života mužů. Jedinci
dosahují normální tělesné výšky, mohou mít mírně deformované kosti, modré zabarvení bělma a trpět nedoslýchavostí. U některých pacientů může být diagnostikována
c
2012
EuroMISE s.r.o.
cs31
Šormová, Mazura, Mařík – Analýza mutací genu COL1A1
dentinogenesis imperfecta (DI). Na základě přítomnosti
tohoto znaku rozlišujeme OI typ IA (absence DI) a OI typ
IB (přítomnost DI). Přítomnost výše uvedených znaků je
vysoce variabilní [9, 17].
OI typ II je perinatálně letální formou. Běžným znakem je mrtvorozenost a vysoká úmrtnost jedinců v perinatálním období, která činí až 80 %. K prvním zlomeninám
dochází již během intrauterinního vývoje plodu. Pacienti
mají vážně deformované kosti, obličej trojúhelníkového
tvaru a modře čí šedě zbarvené skléry. V rámci druhého
typu jsou vyčleněny tři podtypy – IIA, IIB a IIC, a to v závislosti na hodnocení výskytu radiologických znaků jako
jsou deformace žeber a dlouhých kostí, cefalometrických
znaků (makro- či mikrocefalie), typu dědičnosti a mutovaného genu (autozomálně dominantní typy IIA a IIC vznikají v důsledku mutací genů COL1A1 a COL1A2, zatímco
kauzálním genem autozomálně recesivního typu IIB je gen
CRTAP) [2].
Třetí typ onemocnění je mírně deformující autozomálně dominantní či recesivní formou OI. Pacienti jsou
podprůměrného vzrůstu, mají krátké končetiny, vážně deformované kosti, hypermobilní klouby, trojúhelníkový obličej, tmavě modré skléry (během dospívání intenzita zabarvení klesá) a DI. Typickým radiologickým znakem jsou
wormianské kůstky přítomné v lebečních švech a „popcornová“ kalcifikace epifýz a metafýz dlouhých kostí. Z důvodu těžké skoliózy, tenkých diafýz dlouhých kostí a vysoké frekvence zlomenin, k nimž dochází během běžných
denních aktivit, jsou pacienti po většinu života upoutání
na invalidní vozík [13].
OI typ IV je nejvíce heterogenním, autozomálně dominantním typem tohoto onemocnění. Tělesná výška jedinců
je podprůměrná až nízká, kosti jsou deformované a podobně jako u předchozího třetího typu, mohou být epifýzy
a metafýzy dlouhých kostí „popcornové“ struktury. První
fraktury vznikají během porodu, pacienti mají bíle, šedě
či modře zbarvené skléry a mohou mít diagnostikovánu
otosklerózu. Typickým znakem tohoto typu je basilární
imprese. Na základě přítomnosti DI jsou v rámci čtvrtého
typu rozlišovány podtypy IVA (absence DI) a IVB (přítomnost DI) [7].
1.2
Nekolagenní formy osteogenesis
imperfecta
OI type V je autozomálně dominantním typem osteogenesis imperfecta s nejasným genetickým původem.
Jedná se o mírně deformující formu vyznačující se tvorbou hypertrofického kalu v místě zlomeniny a kalcifikací
mezikostní membrány kostí předloktí [5, 12].
Šestý typ této choroby je přenášen autozomálně recesivně. Typickými znaky tohoto typu jsou vzhled kostních
lamel, které svým tvarem připomínají rybí šupiny, a osteopenie. Dlouhé kosti pacientů jsou deformované, metafýzy
mají bulvózní tvar [12, 13]. Tato forma je způsobena mutacemi genu SerpinF1 [5].
c
2012
EuroMISE s.r.o.
OI typ VII je autozomálně recesivní forma OI s vážným až letálním klinickým projevem. Hlavními znaky jsou
rhisomelické zkrácení končetin a exoftalmus. Četnost zlomenin klesá během dospívání jedinců. Tento typ vzniká
v důsledku mutací genu CRTAP [16].
Další autozomálně recesivním typem OI je typ VIII.
Fenotyp postižených jedinců je podobně jako u předchozí
formy velice variabilní – od vážného k letálnímu projevu choroby. Typickým klinickým znakem je rhisomelické
zkrácení končetin, dalšími běžně se vyskytujícími radiologickými znaky jsou bulbózní metafýzy, zkrácení dlouhých
kostí a osteoporóza. Kauzálním genem je gen LEPRE1
[4, 5].
Osteogenesis imperfecta typ IX je mírnou až letální
formou vyznačující se klinickými znaky shodnými s III
a IV typem OI. Choroba je přenášena autozomálně recesivně a je způsobena defektním genem PPIB [9].
Vážný až letální OI typ X, autozomálně recesivní
forma OI, vyplývá z mutací genu SerpinH1. Podobně jako
u typů VII a VIII se tento typ vyznačuje rhizomelickým
zkrácením končetin postižených jedinců [5].
Posledním typem OI je typ XI. Jedná se o autozomálně recesivní onemocnění, které je výsledkem mutací
genu FKBP10. Typickým klinickým znakem jsou podobně
jako u šestého typu kostní lamely tvaru rybích šupin [5].
1.3
Molekulárně genetická podstata
osteogenesis imperfecta
80-90 % všech případů OI má svou genetickou podstatu v mutacích jednoho ze dvou genů kolagenu typ I –
COL1A a COL1A2. Molekula proteinu je tvořena dvěma
alpha1 řetězci kódovanými genem COL1A1 na chromozomu 17 a jedním alpha2 řetězcem kódovaným genem
COL1A2, který se nachází na chromozomu 7. Nesložené
řetězce podléhají mnoha modifikacím (4-prolyl hydroxylace, 3-prolyl hydroxylace, hydroxylace lysinu, glykosylace), které zvyšují stabilitu molekuly proteinu. Takto modifikované řetězce jsou následně ve směru od C- k N-konci
skládány v heterotrimer zakončený N- a C-terminálními
propeptidy (tímto lze vysvětlit fakt, že mutace situované
v C-oblasti molekuly proteinu mají za následek závažnější
postižení jedinců) [1, 9].
Nejdůležitější aminokyselinou vyskytující se v alpha
řetězci je glycin (Gly), který produkuje meziřetězové
vazby. Glycin se nachází na každé třetí pozici 338 repetitivních sekvencí Gly-X-Y a zodpovídá za korektní formaci alpha řetězců do struktury trojšroubovice. Přibližně
75-80 % strukturních defektů kolagenu typ I plyne ze substitucí glycinu jinou aminokyselinou [10]. 36 % substitucí
glycinu kódovanými genem COL1A1 vede v letální fenotyp, zatímco v rámci genu COL1A2 má za následek letalitu 19 % záměn této aminokyseliny [5]. Dalšími klíčovými
oblastmi alpha řetězců jsou místa vazeb transkripčních
faktorů, tedy vazebná místa aktivačních proteinů (tzv.
enhancery a silencery) aktivujících či inhibujících transkripci [6]. Dále mezi ně řadíme oblasti bohaté na CpG.
EJBI – Ročník 8 (2012), číslo 5
cs32
Šormová, Mazura, Mařík – Analýza mutací genu COL1A1
Obrázek 1: Přehled identifikovaných mutací/polymorfismů v genu COL1A1.
Tyto nukleotidy mohou podléhat metylacím, jejichž výsledkem je mírný fenotyp, pokud se tak stane v promotoru, exonu 1 či intronu1, a vážný klinický obraz, pokud se metylované CpG nacházejí v kódující oblasti genů
COL1A1 a COL1A2. V současnosti je popisováno, že tomuto procesu může podléhat 26 z 338 kodonů glycinu v alpha řetězcích [8]. V rámci molekuly kolagenu dále existují tři vazebné oblast, tzv. Multi Ligand Binding Regions (MLBR1-3), které produkují mezimolekulární vazby
s dalšími molekulami pojivové tkáně, jako např. integriny,
oligomerní protein chrupavkové matrix (Cartilage Oligomeric Matrix Protein, COMP), SerpinH1 a další. Vazby
s těmito proteiny zvyšují pevnost a pružnost kostí a je
prokázáno, že mutace oblastí MLBR2 a MLBR3 mají ve
většině případů za následek letální typy osteogenesis imperfecta [5, 15].
1.4
Léčba jedinců postižených
osteogenesis imperfecta
Léčba jedinců s osteogenesis imperfecta je různá a individuální na základě konkrétního klinického, radiologického
a biochemického obrazu. Medikamentózní léčba zahrnuje
užívání kalcia, vitaminu D a léčbu bisfosfonáty, které jsou
běžně podávány při léčbě mírných a vážných forem OI.
Specifickou funkcí bisfosfonátů je inhibice osteoklastů na
povrchu kostí, čímž je docíleno zvýšení hustoty kostí a snížení rizika vzniku zlomenin [3]. Ortotická léčba je indikována u pacientů majících skoliózu a lehké deformity kostí
končetin. Oproti tomu vážné deformity a zlomeniny se signifikantní dislokací jsou léčeny chirurgicky osteotomií a fixací s použitím nitrodřeňových prutů, hřebů, pinů apod.
Vážnou skoliózu lze korigovat chirurgicky zavedením tzv.
Harringtonových prutů, tento způsob léčby však značně
omezuje následný rozsah pohyblivosti páteře. V současné
době jsou vyvíjeny metody tzv. buněčné a genové terapie.
Jejich cílem je nahrazení defektních osteoblastů a deaktivace mutovaných genů, čímž by bylo docíleno zvýšení minerální denzity kostí (buněčná terapie) a snížení klinické
závažnosti OI (genová terapie) [9, 11].
2
Materiál a metody
V rámci této studie byly analyzovány vzorky gDNA
získaných z žilní krve 25 českých pacientů (čtyři nepříbuzné rodiny a sedmnáct sporadických případů) s diagnózou osteogenesis imperfecta typ I-IV – 19 pacientů postiženo OI typem IA, pět pacientů postiženo třetím typem onemocnění a jeden pacient typem IVB. Všichni vyšetřovaní pacienti podepsali informovaný souhlas povolující provedení molekulárně genetické analýzy jejich DNA.
Vzorky krve byly kompletovány na několika pracovištích
České republiky – Praha, Brno, Hradec Králové, Olomouc
a Ostrava. Molekulárně genetické analýzy izolované gDNA
byly zaměřeny na gen COL1A1 proteinu kolagenu typ I.
Genomická DNA byla izolována s použitím QIAamp
DNA Blood Midi Kit (QIAGEN) izolačního kitu a uchována při teplotě -20◦ C. Kvalita DNA izolátů byla ověřena
elektroforeticky, kvantita spektrofotometricky.
Takto ověřené vzorky DNA byly amplifikovány metodou polymerázové řetězové reakce (PCR) s použitím
pro tuto analýzu speciálně vytvořených 100% komplementárních primerů zaměřených na šest regionů DNA zahrnujících exony 31-40. Tato oblast DNA byla vybrána
Tabulka 1: Přehled identifikovaných mutací/polymorfismů českých OI pacientů.
Č. pacienta
OI typ
Pohlaví
1
III
Žena
Věk
(v rocích)
23
2
IA
Muž
22
3
IVB
Žena
52
EJBI – Ročník 8 (2012), číslo 5
Změna nukleotidu
GGC/TGC
ACT/ACC
T/C
C/G
ACT/ACC
T/C
C/G
Mutace/
Polymorfismus
Gly526Cys
Thr588Thr
I32T15375C
I39C17332G
Thr588Thr
I32T15375C
I39C17332G
Umístění v COL1A1
exon 31
exon 33
intron 32
intron 39
exon 33
intron 39
intron 31
c
2012
EuroMISE s.r.o.
cs33
Šormová, Mazura, Mařík – Analýza mutací genu COL1A1
Obrázek 2: Sekvenční struktura exonu 31. Pozice substituce Gly526Cys je vyznačena tučně, záměna nukleotidu je zvýrazněna
červenou kurzívou.
Obrázek 3: Sekvenční struktura exonu 33. Pozice substituce Thr588Thr je vyznačena tučně, záměna nukleotidu je zvýrazněna
červenou kurzívou.
Obrázek 4: Sekvenční struktura intronu 32. Pozice polymorfismu I32T15375C je vyznačena červenou kurzívou.
Obrázek 5: Sekvenční struktura intronu 39. Pozice substituce I39C17332G je vyznačena červenou kurzívou.
na základě přítomnosti oblasti multi ligand binding region 2. Sekvence použitých primerů jsou následující: G1-1
CATCCGTCAAGGTGCGTCG a G1-2 CCTGCCCTGGTCTTTTCCC produkující 350bp dlouhý amplikon zahrnující exon 31; G2-1 CTGGAGTCTGGGCTGTGAG
a G2-2 GTGTTCTGCTTGTGTCTGGG primery syntetizující produkt o velikosti 660bp obsahující exon 32; G3
1 CCAGACACAAGCAGAACACT a G3-2 CTGAGAGCAAGGGACAAGA zaměřené na 402bp dlouhý region
s obsaženým exonem 33; G4-1 TCAACCTGGGAACCTGGAG a G4-2 CAGCATCGCCTTTAGCACC, které produkují 662bp dlouhý PCR produkt zahrnující exony 34
a 35; G5-1 TTCCTGCCTCCATTACT GC a G5-2 AACAGCCAACTCATCCGAC amplifikující oblast o velikosti 426bp obsahující exony 36 a 37; a poslední pár
primerů G6-1 GGTGCTACTGGTTTCCCTGG a G62 TCTGTTCTCCTTGGCTCC GC vymezující 645bp
dlouhý úsek DNA s exony 38, 39 a 40.
Pro polymerázovou řetězovou reakci byla připravena
reakční směs o finálním objemu 50 µl. Složení reakční
směsi bylo následující: 100 ng genomické DNA, 25 µl Taq
PCR MasterMix (1000U) (QIAGEN) (tento mastermix
obsahuje Taq polymerázu (5 U/µl), PCR Buffer, MgCl2
(1,5 mM), dNTPs (4 x 200 µM)) a 0,5 µl (50 pmol) každého primeru.
c
2012
EuroMISE s.r.o.
PCR byla provedena v 35 opakujících se cyklech zahrnujících 0,5 min při 95◦ C, 0,5 min při 59◦ C (systém G1)/
58◦ C (systémy G2, G4 a G6)/ 57◦ C (systém G3)/ 53◦ C
(systém G5), a 1 min při 72◦ C. Získané produkty byly
elektroforeticky ověřeny na 2% agarózovém gelu.
Sekvenční analýza PCR amplikonů genu COL1A1 byla
provedena metodou automatického kapilárního sekvenoR
vání. V této studii byl použit BigDye
Terminator v3.1
Cycle Sequencing Kit (Life Technologies Corporation,
USA).
Získaná data byla porovnávána s odpovídajícími segmenty genu COL1A1 zdravé populace použitím PC proR
gramů DNA Baser a SeqScape
Software for Mutation
Profiling v2.7. Identifikované změny DNA byly následně
porovnávány s databází OMIM.
3
Výsledky
Prostřednictvím molekulárně genetických analýz byly
odhaleny mutace u tří z pětadvaceti českých OI pacientů.
Změny byly nalezeny jak v kódujících, tak v nekódujících
oblastech DNA, konkrétně v exonech 31 a 33 a intronech
32 a 39 (Tab. 1, Obr. 1).
EJBI – Ročník 8 (2012), číslo 5
cs34
Šormová, Mazura, Mařík – Analýza mutací genu COL1A1
Substituce glycinu cysteinem na pozici 526 exonu 31
(Obr. 2) byla odhalena v DNA vzorku pacienta postiženého třetím typem OI (viz. kapitolu 3.1.1). Jedná se o mutaci běžně se vyskytující u této formy choroby. Poprvé byla
popsána v roce 1989 (Starman et al.) [14].
Další mutace kódující sekvence byla odhalena u pacientů s diagnózou osteogenesis imperfecta typ IA (viz. kapitolu 3.1.2) a IVB (viz. kapitolu 3.1.3) (Obr. 3). V obou
případech se jedná o tichou mutaci threoninu na pozici
588 exonu 33. U těchto pacientů byly dále identifikovány
změny v oblastech intronů 32 (Obr. 4) a 39 (Obr. 5).
3.1
Kazuistika
3.1.1
Osteogenesis imperfecta typ III
Prvním popisovaným případem je 23letá žena narozená z druhé gravidity nepostižených rodičů. Porod byl
proveden císařským řezem, následně musel být novorozenec resuscitován. Porodní hmotnost byla 2450g, porodní
délka byla 45cm. Diagnóza byla stanovena ihned po narození pacientky.
mobilní klouby. U pacientky nebyla stanovena ani nedoslýchavost ani dentinogenesis imperfecta. Během porodu došlo ke zlomeninám obou femurů, rentgenové snímky však
dále odhalily zhojené zlomeniny žeber a levé klíční kosti
z prenatálního období. Pacientka utrpěla během dětství
a dospívání četné zlomeniny kostí, především dlouhých
kostí končetin. Poslední fraktura – zlomenina pravé klavikuly, byla zaznamenána v 19 letech. Pacientka začala chodit až ve věku 6 let a to pouze s pomocí ortéz dolních končetin, od jedenácti let je upoutána na invalidní vozík. Osteoporóza byla diagnostikována radiologickým vyšetřením
kostry ve věku 15 a následně potvrzena ve věku 18 let. Snížení denzity kostní hmoty (BMD) bylo zároveň prokázáno
denzitometrickým vyšetřením. Antropologickým a rentgenologickým vyšetřením byly u pacienta potvrzeny následující klinické projevy onemocnění: soudkový tvar hrudníku, deformovaná žebra, pectus carinatum, vážná skolióza, platyspondylie hrudních obratlů, vyšší těla bederních obratlů, bikonkávní tvar obratlů hrudní a bederní
páteře, deformace lebečních kostí, angulace pravého předloktí a femurů, šavlovité deformace humerů a tibií a zkrácené femury. Metafýzi a epifýzy kostí v oblasti kolenních
kloubů vykazují „popcornovou“ strukturu (Obr. 6), tedy
znak typický pro třetí typ této choroby.
Medikamentózní léčba, konkrétně kalcitoninem, byla
zahájena ve věku 7 let. O sedm let později byla u pacienta
zavedena léčba bisfosfonáty. Součástí léčby je dále suplementace kalcia a vitaminu D3. Od věku dvou let podstoupila pacientka několik chirurgických zákroků (korekční osteotomie s nitrodřeňovou fixací). Součástí komplexní léčby
byla ve věku od 6 do 16 let léčba ortotická.
Molekulárně-genetické vyšetření identifikovalo mutaci
typickou pro tento typ OI – Gly526Cys. Další analýzy odhalily u pacientky mutaci genu MTHFR (A1298C), jejímž
důsledkem je zvýšená srážlivost krve.
3.1.2
Osteogenesis imperfecta typ IA
Druhým případem je 22letý muž postižený prvním typem onemocnění. Pacient se narodil z třetího těhotenství zdravého páru. Porodní hmotnost byla 2800g, porodní
délka byla 50cm.
Obrázek 6: „Popcornová“ struktura epifýzy femuru pacienta
s diagnózou třetího typu OI.
Obrázek 7: Světle modré zbarvení bělma u pacienta postiženého OI typem IA.
Klinické znaky prezentované u tohoto jedince jsou
Pacient má modrý kolorit sklér (Obr. 7) a trpí nemodré skléry, trigonocefalie, hyperbrachycefalie, wormian- doslýchavostí a tinnitem. Na kůži obličeje, krku a hrudské kůstky v lebečních švech, mírný exoftalmus a hyper- níku lze pozorovat četné lentigines. Dalšími klinickými
EJBI – Ročník 8 (2012), číslo 5
c
2012
EuroMISE s.r.o.
cs35
Šormová, Mazura, Mařík – Analýza mutací genu COL1A1
znaky jsou štíhlý hrudník s úzkými vertikálně postavenými žebry, vysoké patro, ochablé svalstvo, hypermobilní
klouby a asymetrická ramena. První zlomeninu prodělal
ve věku 2 let, další v 9 letech (fraktura hrudních obratlů),
v 11 letech (fraktura obou loketních kostí) a v 15 letech
života (fraktura druhého metakarpu pravé ruky). Rentgenové snímky zobrazují deformity páteře – napřímení
hrudní kyfózy, oploštění bederní lordózy, platyspondylie
hrudních obratlů a mírná skolióza. Dlouhé kosti dolních
končetin vykazují mírné deformace a pacient má zkrácený
čtvrtý a pátý paprsek nohou. Denzitometrické vyšetření
prokázalo sníženou minerální denzitu kostí vzhledem k danému kalendářnímu věku (Z-skóre je nižší než -2,0).
Pacient je léčen bisfosfonáty, kalciem a vitaminem D3
a podstoupil několik operací zahrnujících nitrodřeňovou
fixaci Kirschnerovými dráty a tympanotomii.
kloubní hypermobilita, zkrácený trup a dolní končetiny
a časté bolesti zad. Ve věku dvou let prodělala četné zlomeniny zejména kostí dolních končetin. Poslední fraktura
byla zaznamenána ve věku 14 let. Radiologická vyšetření
prokazují přítomnost bikonkávních obratlů hrudní a bederní páteře, šavlovité deformity tibií (Obr. 8) a pravého
femuru, varózní krčky kostí stehenních a valgózní paty.
Medikamentózní léčba bisfosfonáty byla u pacientky
zavedena ve věku 42 let. Současně je léčena vitaminem
D3. Pacientka podstoupila pouze jeden chirurgický zákrok
ve věku 47 let, konkrétně korekční operaci levého femuru.
V současnosti se pohybuje s pomocí invalidního vozíku či
francouzských holí a používá kolenní ortézu.
Další molekulárně genetická vyšetření odhalila přítomnost heterozygotní mutace v genu MTHFR (A1298C)
a dále homozygotní mutace 7TA/7TA genu UGT 1A1,
která se projevuje tzv. Gilbertovým syndromem.
3.1.3 Osteogenesis imperfecta typ IVB
Zajímavá je zároveň rodinná anamnéza pacientky, neboť manžel a dcera jsou postiženi syndromem Charcot
V posledním případě se jedná o 53letou ženu posti- Marie Tooth v kombinaci s diabetickou neuropatií. Dcera
ženou čtvrtým typem osteogenesis imperfecta. Jedná se pacientky vykazuje dále svalovou atrofii, křeče a parestezii
o první dítě narozené v rodině bez známek zvýšené fragi- dolních končetin.
lity kostí. Porodní antropometrické parametry pacienta
byly 2840g a 47cm.
4
Diskuze
Osteogenesis imperfecta je vysoce heterogenní onemocnění s molekulárně genetickou podstatou v mutacích
genů kolagenu typ I. Klinický obraz postižených pacientů
vykazuje značné rozdíly jak mezi jednotlivými typy nemoci, tak v rámci stejné formy onemocnění.
V současnosti je ve světové literatuře popisováno několik korelací mezi pozicí mutace a jejím výsledným fenotypovým projevem. Obecně lze říci, že letální fenotyp mají
za následek mutace lokalizované v C-oblasti alpha řetězců,
substituce glycinu a nahrazení aminokyselinového zbytku
aminokyselinou (amk) s rozvětveným postranním řetězcem. Tento fenotyp mají dále za následek mutace vedoucí
v tzv. skipping exonů v 3´ oblasti genu COL1A1 (zejména
exony 14, 20, 22, 27, 30, 44 a 47) a exonů nacházejících
se 5´ k exonu 27 genu COL1A2 a mutace vytvářející nová
střihová místa [8].
V rámci alpha řetězců byly vymezeny dvě oblasti (nazývané MLBR2 a MLBR3) v sekvenci alpha1 řetězce
a osm oblastí alpha2 řetězce, jejichž mutace mají za následek především letální OI typ II nebo III. Naopak mutace
prvních 200 amk zbytků, substituce glycinu v prvních 8590 amk zbytcích, nonsense mutace vytvářející tzv. STOP
kodon a změny v N-terminální oblasti proteinu mají za
výsledek především neletální klinický obraz [4, 8].
Závěrem lze říci, že mutace genu COL1A1 vedou
obecně ve vážnější fenotypový projev onemocnění než muObrázek 8: Šavlovitá deformita levé tibie pacienta s diagnózou tace genu COL1A2. Nesmíme však zapomínat, že exprese
OI typ IVB.
mutací je kromě genetických faktorů dále ovlivňována
např. nutričními či environmentálními změnami. Do této
Pacientka má modré skléry, otosklerózu a trpí onemoc- studie bylo zahrnuto 25 českých pacientů postižených jedněním dentinogenesis imperfecta – druhou dentici ztra- nou z kolagenních forem osteogenesis imperfecta. Defektní
tila již ve věku 20 let. Dalšími znaky jsou generalizovaná DNA byla odhalena u tří z těchto pacientů, přičemž se ve
c
2012
EuroMISE s.r.o.
EJBI – Ročník 8 (2012), číslo 5
cs36
Šormová, Mazura, Mařík – Analýza mutací genu COL1A1
dvou z těchto případů jednalo o nové jednobodové mutace Poděkování
či polymorfismy.
Poděkování patří Mgr. Tomáši Pexovi a RNDr. MarSubstituce glycinu cysteinem na pozici 526 byla sta- kétě Zachové, Ph.D. za poskytnutí laboratorního zázemí
novena u pacienta s třetím typem OI. Poprvé tuto mu- pro molekulárně genetické analýzy a MUDr. Olze Hudátaci popsal Starman et al. v roce 1989 na případu irác- kové za poskytnutí užitečných informací z hlediska klinického chlapce. Klinický obraz popisovaný u iráckého pro- kého popisu jednotlivých typů této choroby. Práce vznikla
banda vykazuje shodné projevy onemocnění jako u čes- za podpory projektu CBI č IM06014 a projektem SVVkého pacienta. Oba jedinci mají modré skléry, defektní 2012-264 513 Univerzity Karlovy v Praze.
tvorbu dentinu (avšak bez příznaků dentinogenesis imperfecta), deformované kosti, wormianské kosti a prodělali během porodu zlomeniny [14]. Substituovaný glycin Literatura
se z hlediska lokalizace mutace v rámci alpha řetězců na[1] Alanay Y, Avaygan H, Camacho N, Utine GE, Boduroglu
lézá v oblasti vazby integrinů. Změny v tomto úseku DNA
K, et al. Mutations in the Gene Encoding the RER Protein FKBP65 Cause Autosomal-Recessive Osteogenesis Imperpostihují tvorbu intermolekulárních vazeb, a tudíž vedou
fecta. The American Journal of Human Genetics. 2010 Apr; 86:
k poklesu pevnosti kostní hmoty. Protože se jedná o nej551–559.
frekventovanější mutaci v rámci třetí formy OI, můžeme
předpokládat, že má tato substituce za následek vážné de[2] Barnes AM, Chang W, Morello R, Cabral WA, Weis M, Eyre
DR, et al. Deficiency of cartilage associated protein in recesformace kostí.
Mutace Thr588Thr byla identifikována u dvou pacientů postižených odlišnými formami OI – typem IA a IVB.
I přesto vykazují oba pacienti shodné klinické rysy, jako
například modrý kolorit sklér, nedoslýchavost, kloubní hypermobilitu či osteoporózu. I když tato mutace nepostihuje transkripci, může mít negativní vliv na následnou
translaci a tvorbu mezimolekulárních vazeb s proteinem
chrupavkové matrix (COMP), který se váže k molekule
kolagenu typ I v oblasti definované kodony 582-638. Lze
předpokládat, že „tiché“ mutace v místech vazeb COMP
mohou být jedním ze signálů budoucího rozvoje osteopenie a osteoporózy. Zatím se však jedná pouze o spekulaci.
V současnosti není tato identifikovaná změna DNA popisována v žádné zahraniční literatuře.
Oba polymorfismy (I32T15375C, I39C17332G), identifikované v rámci této studie, byly nalezeny u pacientů se
substitucí Thr588Thr exonu 33. Žádná z těchto změn nevede ani k tvorbě STOP kodonů, ani k produkci prodlouženého či zkráceného produktu důsledkem vzniku nových
míst střihu. Z toho lze soudit, že nepostihují tvorbu kolagenu typ I. Tyto polymorfismy nebyly doposud popsány
v žádné zahraniční literatuře.
5
Závěr
V současnosti probíhá shromažďování dalšího biologického materiálu (venózní krev, kostní tkáň, embryonální
tkáň) českých pacientů s diagnózou osteogenesis imperfecta typu I-IV pro navazující molekulárně genetické analýzy ostatních kódujících oblastí genu COL1A1. Pro tyto
analýzy je plánováno použití High Resolution Melting
analýzy a technologie Sangerova sekvenování. Studie bude
provedena ve spolupráci s molekulárně genetickou laboratoří Centre for Medical Genetics, Univerzita Antverpy,
Edegem, Belgie.
EJBI – Ročník 8 (2012), číslo 5
sive lethal osteogenesis imperfecta. New Eng J Med. 2006; 355:
2757-2764.
[3] Becker J, Semler O, Gilissen C, Li Y, Bolz HJ et al. Exome
Sequencing Identifies Truncating Mutations in Human SERPINF1 in Autosomal-Recessive Osteogenesis Imperfecta. The
American Journal of Human Genetics. 2011 Mar; 88: 362–371.
[4] Cabral WA, Chang W, Barnes AM, Wies MA Scott MA, Leikin S, et al. Prolyl 3-hydroxylase 1 causes a recessive metabolic bone disorder resembling lethal/severe osteogenesis imperfecta. Nat Genet. 2007 Mar; 39(3): 359-365.
[5] Forlino A, Cabral WA, Barnes AV, Marini JC. New perspectives on osteogenesis imperfecta. Nat. Rev. Endocrinol. 2011; 7:
540–557.
[6] Ghosh AK. Factors Involved in the Regulation of Type I
Collagen Gene Expression: Implication in Fibrosis. Exp. Biol.
Med. 2002; 227: 301-314.
[7] Kashyap RR, Gopakumar R, Gogineni SB, Sreejan CK. Osteogenesis imperfecta type IV. Kerala Dental Journal. 2009 Jan;
32(1): 47-49.
[8] Marini JC, et al. Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions
Rich in Lethal Mutations Align With Collagen Bonding Site
for Integrins and Proteoglycans. Human Mutation. 2007; 28(3):
209-221.
[9] Marini JC. Osteogenesis imperfecta. 2010. Available at:
http://www.endotext.org/parathyroid/parathyroid17
/parathyroid17.pdf. (Revised 1 March 2010).
[10] Marini JC, Cabral WA, Barnes AM. Null mutations in
LEPRE1 and CRTAP cause severe recessive osteogenesis imperfecta. Cell Tissue Res. 2010 Jan; 339(1): 59–70.
[11] Niyibizi C, Wang S, Mi Z, Robbins PD. Gene therapy approaches for osteogenesis imperfecta. Gene Therapy. 2004; 11:
408-416.
[12] Roughley PJ, Rauch F, Glorieux FH. Osteogenesis imperfecta
– clinical and molecular diversity. European Cells and Materials. 2003; 5: 41-47.
[13] Sorin H, Cornel C, Cristian CG, Iuliana P. Osteogenesis imperfecta: forensic assessment of traumatic injuries. Case report
and literature review. Rom J Leg Med. 2008; 16 (4): 275 – 282.
c
2012
EuroMISE s.r.o.
Šormová, Mazura, Mařík – Analýza mutací genu COL1A1
[14] Starman BJ, Eyre D, Charbonneau H, Harrylock M, Weis MA,
Weiss L, Graham JM, Byers PH. The position of substitution
for glycine by cysteine in the triple helical domain of the proalpha1(I) chains of type I collagen determines the clinical phenotype. J. Clin. Invest. 1989; 84:1206–1214.
[15] Sweeney SM, Orgel JP, Fertala A, McAuliffe JD, Turner KR,
Di Lullo GA, et al. Candidate cell and matrix interaction domains on the collagen fibril, the predominant protein of vertebrates. J Biol Chem. 2008 Jul 25; 283(30): 21187-21197.
[16] Ward LM, Rauch F, Travers R, Chabot G, Szout EM, La-
c
2012
EuroMISE s.r.o.
cs37
lic L, Roughley PJ, Glorieux FH. Osteogenesi imperfecta type
VII: an autosomal recessive form of brittle bone disease. Bone.
2002; 31: 12-18.
[17] Wollina U, Koch A. Osteogenesis imperfecta type I and psoriasis – a report on two cases. Egyptian Dermatology Online
Journale. 2006 Jun; 2(1): 15.
[18] Yang Z, Zeng C, Wang Z, Shi HJ, Wang LT. Mutation characteristics in type I collagen genes in Chinese patients with osteogenesis imperfecta. Genetics and Molecular Research. 2011;
10 (1): 177-185.
EJBI – Ročník 8 (2012), číslo 5

Podobné dokumenty

Osteogenesis imperfecta typ I-IV, kolagenní porucha pojivové

Osteogenesis imperfecta typ I-IV, kolagenní porucha pojivové protein), jehož funkcí je stabilizace teploty během syntézy prokolagenu, podpora tvorby a shromažďování molekul prokolagenu a zároveň se tento protein účastní transportu strukturně nepostižených mo...

Více