ekotech kurz základních metod molekulární biologie

Komentáře

Transkript

ekotech kurz základních metod molekulární biologie
EKOTECH
KURZ ZÁKLADNÍCH METOD
MOLEKULÁRNÍ BIOLOGIE
Biologické centrum AV ČR, České Budějovice
Lektoři:
Radmila Čapková Frydrychová
Miroslava Sýkorová
Jindra Šíchová
Václav Brož
OBSAH
STR.
PŘÍPRAVA ROZTOKŮ ………………………………………………………………………………………………………. 1
ELEKTROFORETICKÁ SEPARACE DNA ………………………….………………………………………………….. 4
SPEKTROFOTOMETRICKÉ VYHODNOCENÍ NUKLEOVÝCH KYSELIN …………………………………… 7
IZOLACE NUKLEOVÝCH KYSELIN ………………………………………………………………………………………. 8
PRECIPITACE A ZAHUŠŤOVÁNÍ DNA ………………………………………………………………………………. 14
ŠTĚPEDNÍ DNA: RESTRIKTÁZY ………………………………………………………………………………………… 15
SYNTÉZA cDNA ……………………………………………………………………………………………………………… 17
KLONOVÁNÍ …………………………………………………………………………………………………………………… 19
PCR ……………………………………………………………………………………………………………………………….. 27
SOUTHERNOVA HYBRIDIZACE ……………………………………………………………………………………….. 33
WESTERN BLOT ………………….………………………………………………………………………………………… 39
SEZNAM A PŘÍPRAVA CHEMIKÁLIÍ ………………………………………………………………………………… 41
Ekotech: Kurz základních metod molekulární biologie: Příprava roztoků
PŘÍPRAVA ROZTOKŮ
Příprava roztoků patří k nejzákladnější činnosti v laboratoři, od které se odvíjí všechny následné
experimenty. Z toho důvodu je třeba přípravě roztoků věnovat velkou pozornost a preciznost.
Při přípravě roztoků dbáme na několik základních kroků:
1. Výpočet: stanovení množství látky a vody
2. Rozpuštění látky: Pro přípravu roztoků zpravidla využíváme destilovanou vodu, pro speciální
roztoky tzv. miliQ vodu. Rozpouštění urychlujeme magnetickými míchadélky. Pro zdárné rozpuštění
některých roztoků je nutné zásadité pH, takže např. EDTA se rozpouští za přítomnosti NaOH.
3. Úprava pH: pH je upravováno jen u některých roztoků. Pro úpravu pH používáme nejčastěji pH
metr, případně pH papírky. pH upravujeme pomocí 1M NaOH nebo 1M HCl. pH se upravuje
v přibližně 80 procentech výsledného objemu. Tzn., pokud máme připravit 1l roztoku, chemikálii
nejprve rozpustíme v takovém množství vody, aby objem měl 0,8l. Upravíme pH na požadovanou
hodnotu a roztok doplníme na 1l.
3. Filtrace: ve většině případů se neprovádí
4. Sterilizace: Sterilizaci nejčastěji provádíme autoklávováním a výjimečně filtrací (např. roztok BSA
by se autoklávováním zničil). Láhev s roztokem může být opatřena sterilizační páskou, která indikuje,
že roztok byl vysterilizován autoklávem.
5. Štítek: Láhev s roztokem se řádně označí štítkem, který uvádí název roztoku, koncentraci, datum a
případně jméno toho, kdo roztok připravil.
Množství látky v roztoku může být charakterizováno:
1. Molaritou (např. 1M NaCl)
Využíváme údaj o molární hmotnosti, který zpravidla bývá uveden na obalu chemikálie.
Příklad 1: molární hmotnost (Mr) NaCl je 58.44. 1M roztok NaCl tedy získáme rozpuštěním 58.44 g
v 1l výsledného objemu. Tzn., 58.44 g NaCl doplníme vodou tak, aby výsledný objem roztoku i
s naváženou solí byl 1l.
Příklad 2: 5M roztok NaCl získáme rozpuštěním 292g NaCl v takovém objemu vody, aby výsledný
roztok měl 1l.
Příklad 3: Roztoky většinou připravujeme v menších objemech než 1l. Většinou se jedná o 100ml.
Tedy 100ml 1M roztok NaCl připravíme z 5,8 g NaCl, které doplníme vodou na 100ml.
1
Ekotech: Kurz základních metod molekulární biologie: Příprava roztoků
Příklad 4: Máme připravit 100 ml roztok, který obsahuje 0,5M NaOH a 1M NaCl. Mr NaOH je 40, Mr
NaCl je 58.44. Použijeme tedy 2g NaOH a 5,8 g NaCl. Soli smícháme a doplníme do 100 ml.
2. Procentuelním zastoupením (10% SDS)
Jako 1% roztok je udáván roztok, který vznikne rozpuštěním 1g dané chemikálie ve vodě, tak aby
výsledný objem roztoku byl 100ml.
3. Hmotností látky rozpuštěné v určitém objemu (např. mg/ml)
Tento způsob se většinou využívá u enzymů, např. Proteinázy K.
4. Počtem jednotek (U) v určitém objemu (v případě enzymů)
Zásobní roztoky
Z praktického hlediska je v laboratoři výhodné mít sérii základních tzv. zásobních roztoků. K těmto
roztokům patří především 1M HCl, 1M NaOH, 1M (příp. 5M) NaCl, 1M Tris-HCl (pH7), 1M Tris-HCl
(pH8), 0,5M EDTA (pH8), 3M Na-acetát, 100xTE pufr, 50xTAE pufr, 20xSSC.
Zásobní roztoky se využívají k přípravě jiných (tzv. pracovních) roztoků či roztoků o daleko nižší
koncentraci.
Příklad 1: Máme připravit 10ml roztoku (100mM NaCl, 10mM Tris-HCl, 50mM EDTA) a přitom máme
k dispozici tyto zásobní roztoky 2,5M NaCl, 1M Tris-HCl, 0,5M EDTA. Pro náš roztok tedy použijeme
0,4ml 1M NaCl, 0,1ml Tris-HCl a 1ml 0,5M EDTA.
Příklad 2: Máme 50xTAE zásobního (velice koncentrovaného) roztoku, ze kterého máme vyrobit 2l
1xTAE roztoku. Smícháme tedy 40 ml 50X TAE s 1960 ml vody.
Uchovávání chemikálií
Zakoupené chemikálie je třeba uchovávat dle pokynů uvedených na obalu. Většina chemikálií
(organické a anorganické látky) a většina připravených roztoky se uchovávají v pokojové teplotě (v
angličtině označováno jako RT –„room temperature“). Některé roztoky či chemikálie vyžadují teplotu
okolo 4oC, tedy uskladnění v ledničce, velká část chemikálií a roztoků (většinou enzymy, protilátky)se
skladuje v -20 oC, tedy mrazničce. Ve speciálních případech, jako jsou kompetentní buňky či
dlouhodobé skladování RNA, se vyžaduje teplota okolo -80 oC. Při uchovávání chemikálií je rovněž
třeba brát zřetel na bezpečnost, tj. nikdy neskladovat např. žíravé či jinak nebezpečné chemikálie nad
výškou našich očí, ale preferenčně vždy co nejníže.
2
Ekotech: Kurz základních metod molekulární biologie: Příprava roztoků
Sterilita a čistota prostředí
U velké části experimentů je vyžadováno sterilní prostředí, čehož je získáváno používáním
jednorázového laboratorního plastu, jako např. pipetovacích špiček a zkumavek. Laboratorní plast je
vždy sterilizován autoklávováním. V některých případech se sterilizuje i laboratorní sklo. Při
experimentech se zásadně nosí laboratorní rukavice, vhodný je i laboratorní oděv, nejlépe plášť.
Nošením rukavic a laboratorního oděvu nechráníme jen naše experimenty, ale v mnoha případech
také naše zdraví! V laboratoři zachováváme čistotu a řád laboratoře, pravidelně laboratoř uklízíme a
stíráme laboratorní stoly. Zanedbaná a špinavá laboratoř představuje výrazné ohrožení jak našich
experimentů , tak našeho zdraví. Přednostně vždy dbáme na naší vlastní bezpečnost a bezpečnost
našich kolegů.
3
Ekotech: Kurz základních metod molekulární biologie: elektroforéza
ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN POMOCÍ
HORIZONTÁLNÍ ELEKTROFORÉZY
Elektroforéza je soubor separačních metod, které využívají k dělení látek jejich odlišnou pohyblivost
ve stejnosměrném elektrickém poli. Na principu rozdílných elektroforetických mobilit se při ní dělí
nabité molekuly (ionty). DNA nese díky záporně nabitým fosfátů záporný náboj, proto se pohybuje od
záporného pólu ke kladnému. Při elektroforéze se separují molekuly nukleových kyselin na základě
své délky. Dlouhé fragmenty migrují pomaleji než
kratší, stejně tak jako cirkulární DNA než lineární.
Při horizontální elektroforéze se molekuly DNA a
RNA separují v agarózovém gelu, který je ponořen
do elektroforetického pufru. Koncentrace agarozy
je důležitým faktorem pro mobilitu DNA. Čím
koncentrovanější je agarozový gel, tím separace je
pomalejší, z čehož vyplývá, že vyšší koncentrace
agarozy zajistí lepší separaci krátkých fragmenů.
Pro přípravu elektroforetického gelu a samotnou separaci se
používají ve většině případů TBE pufr nebo (častěji) TAE pufr. Tyto
pufry se uchovávají jako 50x koncentrované a pro
elektroforetickou separaci (ELFO) se ředí na pracovní roztoky o
koncentraci 1x. Vzhledem k vysoké spotřebě ELFO pufru
v laboratoři je výhodné si připravit do zásoby větší množství
pracovního roztoku. Tedy např. připravujeme 2l 1xTAE pufru
smícháním 1960ml vody s 40 ml 50xTAE pufru.
Příprava gelu a elektroforetické vaničky
Množství připravovaného gelu závisí na počtu vzorků a tedy
velikosti ELFO vaničky. Nejčastěji se používá 40ml vanička, a to
pro separaci 8 nebo 12 (v závislosti na velikosti hřebene) vzorků.
Koncentrace gelu závisí na typu fragmentů DNA, které chceme
separovat. Vyšší koncentrace agarozy zajistí lepší separaci
krátkých fragmentů. Koncentrovanější gely umožňují jemnější
rozlišení velikosti kratších fragmentů. Pro dlouhé fragmenty okolo 1000bp postačí gely s koncentrací
nižší než 1%. Pro krátké fragmenty můžeme při použití speciální agarózy o nízkém bodu tání připravit
až 4% gel, který umožní rozlišení fragmentů o velikosti okolo 200bp, lišící se 15 páry bází. Pokud
vyžadujeme ještě jemnější rozlišení, musíme použít polyakrylamidový gel a vertikální elektroforézu.
Takže např. pro 40 ml 1% agarozového gelu použijeme 40 ml 1X TAE pufru a 0,4g agarozy. Agarozu
smícháme s pufrem nejlépe v lahvi se šroubovacím víčkem, lahev uzavřeme tak, že je víčko částečně
povolené. Agarozu rozpustíme v mikrovlnné troubě, obvykle stačí 1-1,5 min. V průběhu rozehřívání
můžeme 1-2x roztokem zamíchat. Agaroza musí být dokonale rozpuštěna, tzn. nesmí být patrná
4
Ekotech: Kurz základních metod molekulární biologie: elektroforéza
žádná zrnka tající agarózy. Připravený gel necháme zchladnout tak, aby již nebyl vařící, ale přesto
dostatečně horký na to, aby nezačal tuhnout. Pokud nám gel nedopatřením ztuhne, můžeme ho
opětovně rozpustit.
Připravíme si ELFO vaničku, jejíž čela jsme předtím důkladně oblepili lepící páskou či izolepou (v
některých případech jsou vaničky dodávány s kovovými pásky, kterými vaničku utěsníme).Do vaničky
vložíme ELFO hřeben a vlijeme agarozový gel , který poté necháme dokonale ztuhnout.
Pozn. V některých laboratořích se přidává do gelu etidium bromid, který nám v závěrečné fázi umožní
vizualizaci DNA či RNA. Nicméně jelikož je etidium bromid silný mutagen, z bezpečnostního hlediska
(kvůli odpařování a kontaminaci laboratorního prostředí) je doporučováno gel barvit až po
elektroforéze.Rovněž etidium bromid nepatrně ovlivňuje mobilitu DNA, což v některých případech
experimentů není žádoucí.
Příprava vzorků
Ke vzorkům přidáme 10xnanášecí pufr („loading buffer“). Nanášecí pufr
obsahuje bromfenol ovou modř, která roztok s DNA obarví, což umožní lepší
nanášení vzorku na gel a sledování vzorku při separaci. Nanášecí pufr také
obsahuje glycerol, který způsobí usazení vzorku na dno jamky gelu. Někdy
nanášecí pufr obsahuje i EDTA, která umožní zastavení případné např. restrikční
reakce. Nanášecí pufr je obvykle v koncentraci 10x, tzn., pufr s roztokem DNA
mícháme v poměru 1:9. Kapacita jamky závisí na velikosti hřebene. U hřebenů
s jemnými zuby je objem jamky cca 10 µl, u středních zubů to je cca 20 µl.
1kb ladder plus
Nanášení vzorků
Vaničku usadíme do elektroforetické vany , tak aby jamky byly u záporného pólu. Gel s vaničkou
zalijeme 1x ELFO roztokem. Hladina ELFO roztoku by měla být těsně (1-2 mm) nad gelem. S vyšší
vrstvou pufru nad gelem stoupá při elektroforéze odpor a
separace je pomalejší.
Vzorky naneseme do jamek, díky přítomnosti glycerolu, vzorky
klesnou na dno jamky. Pro nanášení používáme 1-20µl pipetu.
Do jedné z jamek rovněž naneseme hmotnostní marker („size
marker“ nebo také „ladder“), obvykle kolem 5µl. Marker
obsahuje soubor velikostně definovaných fragmentů, které
nám po separaci umožní identifikaci velikostí molekul
testované DNA (viz. obr.).
Separace vzorků
5
Ekotech: Kurz základních metod molekulární biologie: elektroforéza
ELFO vanu přikryjeme víkem a zapneme ELFO zdroj. Nastavíme napětí, tak aby bylo 5-8V/cm mezi
elektrodami. Tzn. u malé až střední elektroforetické vany to je 60-90V. Vyšší napětí nám umožní
rychlejší separaci vzorku, ale pokud je příliš vysoké, dochází k přehřívání, deformaci gelu a
nestejnoměrné separaci vzorků. Elektroforézu necháme běžet maximálně tak dlouho až je
bromfenolová modř ve 2/3 až ¾ délky vaničky.
Barvení vzorků
Gel vyjmeme z vaničky a ponoříme ho na 10-20 min do vodného roztoku etidium bromidu *(20µl
1%EtBr/100ml H2O), případně GelRed či případně SyberGreenu. Jsou to látky, které se váží na DNA a
v UV spektru září modrým fluorescenčním zářením. To nám tedy umožní vizualizaci nukleové
kyseliny. Během barvení roztokem protřepáváme. Po obarvení opatrně gel y barvícího roztoku
vyjmeme, opláchneme vodou a vizualizujeme pod UV světlem.
*Zásobní roztok etidium bromidu bývá 1%, tj. 10mg/ml. Pracovní roztok skladujeme ve tmě a lze jej
využívat opakovaně,
EXTRAKCE DNA Z GELU
K určitým účelům můžeme DNA z gelu extrahovat, např. pro klonování. Z gelu pod UV světlem
vyřízneme daný proužek DNA. Pro excizi používáme skalpel případně kopistku a dbáme na dvě věci:
jednak máme ochranný štít či brýle proti UV (zánět spojivek by byl jinak jistý) a za druhé pracujeme
urychleně, protože UV na DNA vytváří tyminové dimery, které by mohly způsobovat problémy
v následných experimentech. DNA z vyříznutého gelu následně extrahujeme pomocí komerčně
dostupných kitů (firma Qiagen, Macherez Nagel, Invitrogen, Promega, aj.).
6
Ekotech: Kurz základních metod molekulární biologie: Spektrofotometrické vyhodnocení nukleových kyselin
SPEKTROFOTOMETRICKÉ VYHODNOCENÍ
NUKLEOVÝCH KYSELIN
Roztok DNA se spektrofotometricky vyhodnocuje při vlnové délce 260nm a 280nm. Absorbance při
260 nm odráží koncentraci DNA, absorbance při 280 nm odráží čistotu DNA, tj. míru přítomnosti
proteinů.
Pro výpočet koncentrace se vychází z následujících vztahů:
Při vlnové délce 260 nm je absorbance roztoku rovna 1, pokud je v měřeném roztoku:
- dvouřetězcová DNA o koncentraci 50 µg/ml
- jednořetězcové DNA o koncentraci 37 µg/ml při 260nm DNA je rovna 1
- RNA o koncentraci 40 µg/ml při 260nm DNA je rovna 1
Obvyklý postup při spektrofotometrickém vyhodnocení dsDNA:
1. Roztok DNA se naředí. Obvykle je to buď 50x nebo 100x nebo 1000x. Protože přesnější měření
získáme při vyšší koncentraci DNA, je ředění DNA kompromisem mezi přesností měření a množstvím
DNA, které kvůli měření ztratíme. Směrodatným faktorem je rovněž typ a velikost
spektrofotometrické kyvety a typ spektrofotometru (tj. především výška probíhajícího paprsku).
Roztok DNA tedy naředíme např. 100x, tj. 1:100. Roztok důkladně promícháme.
2. Nejprve spektrofotometr vynulujeme oproti slepému vzorku („blank“), kterým je obvykle voda,
která byla použita pro ředění roztoku DNA.
3. Změříme absorbanci roztoku DNA při 260 nm a poté při 280nm.
Výsledná hodnota je např. A260=0,02, A280=0,009.
4. Vypočteme poměr A260/A280, který nám poskytuje informaci o
čistotě DNA. Ćistá DNA obvykle vykazuje hodnotu tohoto poměru okolo
1,8, u RNA je to okolo2. Pokud hodnota poměru je výrazně nižší, je DNA
kontaminována proteiny či fenolem. V našem případě je
A260/A280=2,2.
5. Vypočteme koncentraci DNA dle A260 a vztahu uvedeného v textu
výše a míře naředění roztoku DNA.
V našem případě tedy 50 x 0,02 x 100 = 100 µg/ml = 100ng/µl
Obecně pro ds DNA: 50 x A x ředění = ng/µl
Obr. Spektrofotometrické kyvety
Obecně pro ss DNA: 37 x A x ředění = ng/µl
Obecně pro RNA:
40 x A x ředění = ng/µl
Při měření více vzorků a také po skončení měření dbáme na důkladné vypláchnutí spektrofotometrické kyvety.
7
Ekotech: Kurz základních metod molekulární biologie: Izolace nukleových kyselin
Izolace DNA
V současné době existuje několik různých způsobů jak izolovat DNA.
1. Klasickým způsobem je izolace pomocí fenol-chloroformu. Tato izolace je poměrně pracná a
zdlouhavá, ale poskytuje velké množství velmi čisté DNA.
2. Druhým způsobem je izolace pomocí kolonek (např. od firem Qiagen, Invitroge nebo, Macherey
Nagel). Izolace pomocí kolonek je rychlá, elegantní a většinou odpadá práce s tekutým dusíkem.
Tkáň pomocí tloučku rozdrtíme v extrakčním pufru. Tento roztok naneseme do speciální kolonky,
kterou centrifugujeme. V kolonce je přítomna matrix, na kterou se DNA navazuje. DNA se promyje
centrifugací se speciálními roztoky. Po promytí se DNA vyváže centrifugací s vodou, která DNA
z matrix odplaví. Při tomto způsobu ovšem není možné získat velké množství DNA a DNA není prý tak
čistá.
3. Kompromisním řešením mezi fenolovou extrakcí a kolonkami jsou nejrůznější produkty dostupné
od řady firem (např. DNazol od firmy MRC), které pracují na podobné bázi jako je izolace fenolem, ale
poskytují daleko větší jednoduchost a rychlost.
4. Speciální izolací DNA je izolace pomocí Chelexu. Chelex poskytuje extrakci DNA z velmi malého
množství materiálu, jakým je např. lidský vlas. Čistota DNA je velmi nízká, ale je dostatečná pro PCR.
Tato metoda se využívá ve forenzní genetice.
Izolace kolonkami a způsobem popsaným v bodě 2 se vždy striktně odvíjí od návodu výrobce. Proto si
zde uvádíme podrobný popis izolace DNA pouze fenol-chloroformovou extrakcí a Chelexem.
Izolace DNA fenol-chloroformem
Přípravné práce:
1. Sterilizace keramických třecích misek, tloučků a kopistek (zabalit do alobalu) v autoklávu.
2. Předchlazení keramických třecích misek, tloučků a kopistek uložením do mrazáku
3. Příprava 10 ml extrakčního pufru:
Finální koncentrace
Základní roztok
100 mM NaCl
1 M NaCl (14,61 g ve 100 ml s miliQ H2O)
10 mM Tris-HCl, pH 8,0
1 M Tris-HCl, pH 8,0
50 mM EDTA, pH 8,0*
0,5 M EDTA (18,61 g ve 100 ml s mQ H2O)
0,5% Sarkosyl
10% (1g sarkosylu + 9 ml miliQ H2O)
0,5 ml
100 µg/ml Proteináza K**
20 mg/ml (-20°C)
50 µl
miliQ H2O
Množství
1 ml
100 µl
1 ml
7,35 ml
8
Ekotech: Kurz základních metod molekulární biologie: Izolace nukleových kyselin
* Koncentrace EDTA závisí na množství endogenních nukleáz ve vzorku či tkáni (používané finální
koncentrace: 25-100 mM EDTA). Základní roztok: 18,61 g + 80 ml H2O + 2 g NaOH, po
rozpouštìní dotitrovat na pH 8,0 (NaOH/HCl) a doplnit na 100 ml.
** Proteinázu přidat ze základního roztoku do extrakčního pufru až před použitím!
Vlastní izolace genomové DNA
Uvedený protocol je pro izolaci většího množství tkáně v 10 ml extrakčního pufru. Množství tkáně a
extrakčního pufru lze snížit a izolaci provádět v 1,5ml zkumavkách.
Rozmělnění tkáně v extrakčním pufru a inkubace v extrakčním pufru
1. Zchlazení třecích misek a tloučků pomocí tekutého N2: dusík nalejme do misky a postupně ho
přiléváme až do řádného zchlazení misky, při kterém již nebude docházet k výraznému odpařování
dusíku.
2. K dusíku v misce přidáme studovanou tkáň a pomocí tloučku ji rozmělníme na jemný prášek.
Přidáme několik kapek extrakčního pufru a znovu rozmělníme. Získaný prášek kopistkou přeneseme
do zkumavky s extrakčním pufrem (0,1-0,2 g tkáně na 10ml extrakčního pufru).
3. Přidáme proteinázu K (pokud není již v extrakčním pufru) a zkumavku, jejíž uzávěr jsme předtím
utěsnili parafilmem, vložíme v horizontální poloze do vodní lázně a zvolna promícháváme (37°C, 3-12
hod.).
Fenolová extrakce
4. Roztok necháme zchladnout na pokojovou teplotu, přidáme stejný objem fenolu (bez vrchní krycí
vrstvy TE pufru!) a zvolna promícháváme na třepačce (RT, 30 min.). Přidáním fenolu se vytvoří dvě
faze. Horní je roztok s DNA, spodní je vrstva fenolu. Po 30 minutách přeneseme obě faze do 15 ml
Corex zkumavky.
pH použitého fenolu musí být 8. Fenol vhodný určený pro izolaci DNA lze již přím koupit nebo si ho
lze v laboratoři připravit. Způsob přípravy je uveden dale v textu.
5. Centrifugací (5000 g, 15 min., RT) oddělíme tři vrstvy - DNA, bílkoviny a fenol. Vrchní viskózní
vodnou fázi, jež obsahuje DNA, opatrně a velmi zvolna odsajeme a přeneseme do nové falconky.
Pro nasávání DNA používáme vždy špičky s ustřihlým koncem (průměr otvoru
3 mm)! Při
centrifugaci dbáme na nízkou akceleraci a deceleraci centrifugy!
6. Fenolovou extrakci, tj. body 4,5, opakujeme 1-2x. Mezitím si připravíme směs fenol-chloroformizoamylalkohol (25:24:1). Směs musí být průhledná, pokud není - centrifugace (5000 g, 6 min., RT).
9
Ekotech: Kurz základních metod molekulární biologie: Izolace nukleových kyselin
Fenol-chloroformová extrakce
7. Přidáme stejný objem fenol-chloroform-izoamylalkoholu a v horizontálním směru zvolna
promícháváme na třepačce (RT, 15 min.).
8. Přeneseme do 15 ml Corex zkumavky a centrifugujeme (5000 g, 15 min., RT) a horní fázi
přeneseme do nové falconky (velice opatrně a zvolna).
Chloroformová extrakce
9. Přidáme stejný objem chloroform-izoamylalkoholu (24:1) a horizontálně zvolna promícháváme na
třepačce (RT, 15 min.).
10. Centrifugujeme (5000 g, 15 min., RT), horní fázi přeneseme do zkumavky.
Precipitace DNA a její rozpuštění
11. Přidáme 0,1 objemu 3M Na-acetátu (pH 5,2) a promícháme jemným pohybováním falconky v
horizontálním směru, dokud obsah není homogenní.
Přidáme 2x objem 100% etanolu a opět opatrně promícháme:
- pokud se DNA zformuje v klubko vláken, vytáhneme ji
háčkem vyrobeným ohnutím špičky sterilní pasterky a
přeneseme do falconky se 70% etanolem (na 2 min.);
- pokud nejsou DNA vlákna dostatečně zformována,
shlukneme je centrifugací zkumavce (3000 g, 10 min., RT).
Opatrněodlejeme etanol. Klubko či pellet DNA 2x promyjeme
přidáním 70% etanolu a zcentrifugováním (3000 g, 10 min., RT).
Etanol odlejeme, krátce (5 min.) necháme vyschnout (kapky
etanolu usazené po stěnách můžeme případnězcentrifugovat a odsát pipetou).
DNA nesmí úplně vyschnout, jinak se špatně rozpustí!
Přidáme takové množství TE pufru (pH 8,0) nebo autoklávované miliQ H2O, aby přibližná koncentrace
DNA byla 500 ng - 1 µg DNA/µl.
DNA resuspendujeme jemným pohybováním zkumavky v horizontálním směru a umístíme na noc do
4°C.
Genomová DNA je velmi křehká a náchylná k mechanickému poškoyení. Proto s ní musíme nakládat
velmi jemně.
Nejčastější příčiny degradace vysokomolekulární DNA:
1. Nedostatečná inhbice DNáz
10
Ekotech: Kurz základních metod molekulární biologie: Izolace nukleových kyselin
2. Prudké míchání či třepání
3. Pipetování
4. Vysoká akcelerace či decelerace centrifugy
Izolovanou DNA vyhodnotíme spektrofotometricky a elektroforeticky.
Spektrofotometricky
vyhodnotíme
jak
koncentraci DNA pomocí absorbance při
260nm, tak čistotu DNA pomocí poměru
A260/A280 (viz. kapitola Spektrofotometrické
vyhodnocení
nukleových
kyselin).
Elektrofoteticky vyhodnotíme integritu DNA.
DNA by měla být patrná jako celistvý
vysokomolekulární proužek.
Úprava pH fenolu:
(a) K fenolu přidáme stejný objem 1 M TRIZMA BASE (60,55 g doplnit na 500 ml miliQ H2O; pH 12);
protřepáním oddělíme dvěfáze, z nichž vrchní odstraníme.
(b) Přidáme stejný objem 1 M Tris-HCl (pH 8,0); protřepáním oddělíme dvě fáze, z nichž vrchní
odstraníme. Poté zkontrolujeme pH a případně zopakujeme tento krok.
Příprava 500 ml 1 M Tris-HCl:
26,5 g TRIZMA BASE + 44,4 g TRIZMA HCl, rozpustit ve 400 ml miliQ H2O a doplnit na 500 ml.
(c) Přidáme 10mM Tris-HCl (pH 8,0), protřepeme, necháme sednout a oddìlíme vrchní fázi.
(d) Krok (c) opakujeme 3x kvůli odstranění solí a zkontrolujeme pH pomocí papírku. Po titraci slejeme
a zalejeme 1x TE pufrem (pH 8,0).
Takto upravený fenol vydrží při 4°C 2-3 mìsíce (skladujeme nejlépe v 50ml falconkách).
Pozor !!!
Časem u takto uskladněného fenolu může dojít k jeho znehodnocení oxidací (žlutá
barva se mění v červenou).
11
Ekotech: Kurz základních metod molekulární biologie: Izolace nukleových kyselin
Izolace DNA pomocí Chelexu
Extrakce DNA pomocí Chelexu 100 (Bio-Rad Laboratories) je velmi populární metodou ve
forenzní genetice, kde se používá k izolaci DNA ze zaschlých krevních vzorků, tkáně, vlasů a kostí.
Tato metoda je velmi rychlá a poměrně levná. Velkou výhodou je minimální riziko kontaminace
vzorku, díky tomu, že je celý proces extrakce prováděn pouze v jedné zkumavce.
Chelex je pryskyřice složená ze styren divinylbenzen kopolyméru (makromolekulární látka,
jejíž molekuly jsou tvořeny nejméně ze dvou různých monomérů) s párovými iminodiacetátovými
ionty. Tyto ionty působí jako chelátory, které vážou polyvalentní kovové ionty. Za alkalických
podmínek zvyšuje Chelex afinitu ke kationtům těžkým kovům (Ca2+, Mn2+, and Mg2+), což má
v extrakci velký význam, jelikož tyto dvojmocné ionty mohou při vysoké teplotě (95-100°C) způsobit
poškození DNA. Kromě toho chelatace Mg2+ iontů způsobuje inaktivaci nukleáz (např. DNáz
degradujících DNA), což je při izolaci DNA nezbytné, jelikož jsou Mg2+ ionty nezbytné pro jejich
enzymatickou aktivitu.
Principem izolace je fyzická homogenizace a následná destrukce a degradace buněčných
membrán, proteinů a denaturace DNA z alkalických podmínek a vysoké teploty (95-100°C). Dále se
provede centrifugace suspenze, tak aby se oddělila pryskyřice a zbytky buněčných komponentů od
supernatantu obsahujícího DNA. DNA se může přímo používat pro PCR amplifikaci, avšak je třeba
zamezit kontaktu pryskyřice s PCR reakcí, jelikož Chelex samotný je inhibitor PCR.
Postup:
Potřebujeme: 10% chelex ve sterilní H2O, sterilní H2O, Proteinázu K (c = 20 mg/ml), tloučky, 1,5 ml
zkumavky, 2 termobloky, pinzetu, kahan, nůžky, TAE, agarózu, loading buffer
1) Připravíme 10% roztok chelexu (1 g chelexu do 9 ml miliQ H2O), řádně promícháme.
2) Termoblok nahřejeme na 56 °C.
3)
Do označené mikrozkumavky (1,5 ml) odpipetujeme 50μl roztoku. Doplníme 50 μl miliQ H
výsledná koncentrace chelexu je tak 5%.
2O,
4) Pinzetou (sterilizovanou nebo předem namočenou do etanolu a opálenou, pak musí na vzduchu
trochu vychladnout) vyškubneme asi 3-5 vlasů i s kořínky (kořínky jsou u vlasů nejlepším zdrojem
DNA, protože pouze ony obsahují živé buňky) a přeneseme do mikrozkumavky s chelexem.
5)
Zvortexujeme a stočíme, aby se vlasy dostaly do tekutiny. Provedeme homogenizaci zeleným
tloučkem.
6) Přidáme 2,5 μl Proteinázy K (koncentrace 20 mg/ml).
7) Znovu zvortexujeme.
8) Inkubujeme 10 min při 56 °C.
12
Ekotech: Kurz základních metod molekulární biologie: Izolace nukleových kyselin
9) Mezitím nahřejeme druhý termoblok na 95-100 °C.
10) Po inkubaci vzorky vortexujeme 10-15 s.
11) Inkubujeme (respektive povaříme) 10 min. při 95-100 °C.
13) Znovu zvortexujeme 10-15 s.
14 Vzorky zcentrifugujeme 5 min při maximální rychlosti. Poté vzorky vyhodnocujeme pomocí PCR. Do
PCR reakce dáme přímo 2 μl supernatantu. PCR přečistíme pomocí komerčně dostupných kolonek na
přečišťování PCR produktů (např. Wizard SV Gel and PCR Clean-Up System od firmy Promega).
IZOLACE RNA
Podobně jako u izolace DNA, RNA může být izolovaná několika způsoby - používají se speciální
kolonky, jejichž matrix na sebe z roztoku navazuje RNA, dále to je metoda pomocí fenol-chloroformu
a konečně je to celá řada různých komerčně dostupných produktů, jako např. velmi používaný Trizol
nebo RNazol. Obecná zásada při práci s RNA je dodržování
čistoty, striktní používání rukavic, špiček s filtrem, speciálně
ošetřené vody (např. tzv. DEPC vody), která neobsahuje RNázy.
RNA je velice náchylná na působení RNáz. Kontaminace RNázami
vede k degradaci vzorku RNA, což se projeví při elektroforetické
separaci v podobě „smearu“. Správně izolovaná totální RNA je se
jeví jako dva celistvé proužky (horní proužek je 28S RNA, dolní je
tvořen 18S RNA).Nejčastějším způsobem je izolace totální , tj.
celkovou RNA. V určitých případech (výroba sond pro array
analýzu, detekci extrémně vzácné mRNA nebo konstrukce
random-primed cDNA knihoven), kdy by totální RNA byla na
obtíž, izolujeme jen poly(A), tj. mRNA, která tvoří 1-5 % totální
RNA). Pro izolaci mRNA existují komerčně dostupné kity, jako
Oligotex mRNA od firmy Qiagen nebo Poly(A)Purist™ Kit od
Ambionu.
13
Ekotech: Kurz základních metod molekulární biologie: Precipitace a zahušťování DNA
PRECIPITACE A ZAHUŠŤOVÁNÍ DNA
Nízkou koncentraci DNA můžeme zvýšit v podstatě dvěmi způsoby.
Jedním je centrifugace roztoku DNA v komerčně dostupných kolonkách, které po přidání speciálního
pufru o určitém objemu k roztoku DNA, vyvazují DNA na speciální matrix. DNA je poté odplavena
z této matrix centrifugací vody nebo elučního pufru (obvykle se minimum vody či elučního pufru
pohybuje od 30-50 µl, což může být pro náš účel limitujícím faktorem).
Druhým způsobem je precipitace DNA pomocí Na-acetátu a etanolu. Pro tento způsob uvádíme
přesný postup.
K roztoku DNA je přidán 3M Na-acetát(pH 5.2) a to o objemu, který je roven 1/10 finálního objemu.
Tedy pokud máme roztok DNA o objemu 300 µl, přidáme 33 µl 3M Na-acetátu. Pokud máme velmi
malé množství DNA, k vzorku přidáme glykogen nebo tRNA, které usnadní zviditelnění peletu DNA po
centrifugaci.
Do roztoku přidáme 2-2,5x objemu 100% etanolu. Precipitace je zvýšena, pokud je etanol vychlazen
na -20 oC. Vzorek se řádně promíchá vortexem, v případě že se jedná o genomovou DNA,
promícháme vzorek velmi zlehka pipetováním (genomová DNA je citlivá na mechanické poškození).
Vzorek uložíme na 30 min do -20 oC (eventuálně přes noc) nebo na 30-60 min do -80 oC. V případě
nízkého množství DNA je lepší delší inkubace buď v -20 oC nebo 1 hodinu v -80 oC.
Vzorek centrifugujeme v předchlazené centrifuze (4 oC), 13 000 rpm, 20min.
DNA formuje pelet na dně zkumavky, supernatant opatrně odstraníme. A přidáme stejný objem 70%
etanolu.
Vzorek centrifugujeme při 13 000rpm, 10 min, 4 oC. Dokonale odstraníme supernatant. Počkáme až
se odpaří všechny zbytky etanolu a přidáme vodu či TE pufr a necháme DNA rozpustit. Pokud DNA
není genomová, můžeme rozpouštění usnadnit vertexem či pipetou.
14
Ekotech: Kurz základních metod molekulární biologie: Štěpení DNA: restriktázy
ŠTĚPENÍ DNA: RESTRIKTÁZY
DNA lze štěpit mechanicky pomocí sonikace nebo enzymaticky. Sonikace je štěpení DNA pomocí
ultrazvuku, který rozkmitá dlouhé molekuly. Ty se pak v místech největšího mechanického namáhání
v průběhu kmitání lámou. Velikost získaných fragmentů lze ovlivnit výkonem ultrazvuku a dobou
působení - čím větší výkon a delší působení, tím kratší fragmenty. Místa zlomu jsou ovšem zcela
nezávislá na konkrétní sekvenci DNA a jsou tedy náhodná.
Restrikční endonukleázy (taky též restriktázy)
Štěpení DNA lze provádět pomocí enzymů tzv. nukleáz. Existuje celá řada nukleáz, které štípou DNA
svým specifickým způsobem. Nejvýraznějšího uplatnění ale
nachází restrikční endonukleázy. Restrikčních endonukleázy
II. typu rozpoznávají v molekule DNA krátké specifické
sekvence a v místě výskytu této sekvence molekulu štěpí.
Štěpená sekvence je plindromická, tzn. identická v obou
řetěcích, pokud ji čteme vždy v jednom směru tj. 5’-3’ nebo
3’-5’. Jako příklad můžeme uvést nejznámější restrikční
endonukleázu EcoRI (podle zdroje - bakterie Escherichia coli,
RI = restriktáza č. 1), která rozpoznává sekvenci 5'-GAATTC-3'
a štěpí fosfodiesterovou vazbu v řetězci mezi prvním
guanosinem (G) a druhým adenosinem (A).
EcoRI patří do podskupiny restrikčních endonukleáz II. typu, které štěpí obráceně opakované
sekvence, takže vznikají fragmenty s tzv. kohesivními konci. Jiné restrikční endonukleázy II. typu
štěpí fosfodiesterové vazby na stejném místě v obou řetězcích, takže vznikají tzv. tupé konce
(viz. obr.).
Štěpení restrikčními endonukleázami dovoluje, při určitých podmínkách a přítomnosti enzymu tzv.
DNA ligázy, rozštěpené molekuly zase spojit dohromady. Snížením teploty dosáhneme mezi
štěpenými konci spojení vodíkovými můstky a pomocí enzymu ligázy můžeme obnovit
fosfodiesterové vazby mezi řetězci.
15
Ekotech: Kurz základních metod molekulární biologie: Štěpení DNA: restriktázy
Komerčně je dostupná celá řada restrikčních enzymů, viz. firma NEB – New England Biolabs.
Restrikční endonukleázy jsou dodávány s pufrem, ve kterém pracují. Aktivita různých restriktáz se
s různými pufry může výrazně lišit. Tak např. od firmy NEB enzym EcoR I pracuje se 100%-ní účinností
ve všech čtyřech dodávaných pufrech (1,2,3, a 4). EcoR V pracuje v pufrech 1,2,3 a 4 s účinností 50,
75, 100 a 50. Pokud chceme provádět reakci s např. dvěma enzymy současně, vždy musíme
zkontrolovat jejich aktivitu v daných pufrech a použít optimální pufr pro oba enzymy. Pokud se
aktivita výrazně liší, buď použijeme univerzální pufr nebo provedeme reakci nejprve s jedním
enzymem, DNA přečistíme (buď komerčně dostupnou kolonkou nebo precipitací s Na-acetátem) a
provedeme reakci s druhým enzymem. Enzymy jsou dodávany v určitém množství jednotek na určité
množství. Výrobce vždy uvádí specifikaci, kolik jednotek nám rozštěpí dané množství DNA za daný čas
většinou při 370C.
Prakticky se restrikční štěpení ale dělá tak, že se k 1µg DNA přidá 0,5µl restriktázy, což je obvykle
množství enzymu, které DNA dokonale naštěpí. Pokud děláme reakci s více enzymy, vždy mějme na
paměti, že objem dodaných enzymů nesmí přesáhnout desetinu celkového objemu reakce (glycerol,
který nese enzymy by v takovém množství inhiboval reakci). Dodávané pufry jsou většinou 10x
koncentrované a reakce se u většiny enzymů (ale neplatí to vždy!) provádí při 370C 1-2 hodiny.
Reakční podmínky je vždy třeba zkontrolovat pro daný enzym. K inaktivaci reakce se používá EDTA,
která vyvazuje dvojmocné ionty, které jsou potřebné k aktivitě restriktázy (po přídavku EDTA jsou
dvojmocnoé ionty pro restriktázu nedostupné) nebo se inaktivace dělá vysokou teplotou dle návodu
výrobce.
Příklad reakce:
Komponenta
H2O
plasmidová DNA (1 µg)
10x pufr –(NEB 3)
EcoR I
EcoR V
Celkem
Množství
10,5 µl
10 µl
2,5 µl
1 µl
1 µl
25 µl
Reakci promícháme a inkubujeme při 370C 1-2 hodiny. Reakci můžeme inaktivovat inkubací při 650C
20 min.
16
Ekotech: Kurz základních metod molekulární biologie: Syntéza cDNA
SYNTÉZA cDNA
Syntéza cDNA je syntézou DNA podle templátové RNA molekuly. Syntéza je zprostředkována
speciálním enzymem RT transkriptázou (tj. reverzní transkriptázou). Syntéza cDNA umožňuje
manipulaci (klonování a další úpravy) s produkty transkripce a tím vlastně s funkčními součástmi
genomu. Syntézou cDNA můžeme získat kódující sekvenci celých genů, tj. sekvenci bez intronů. Pro
iniciaci syntézy jsou jako primery využívány polydT (komplementární k polA na konci každého genu)
nebo se využívá směs náhodných hexanukleotidů, nebo i specifické oligonukleotidy, pokud chceme
cDNA jen k nějakému konkrétnímu genu a máme nějakou informaci o sekvenci.
Syntéza cDNA probíhá v těchto krocích:
1. denaturace RNA a primeru při 65oC– tj. odstranění případných sekundárních struktur, které se na
RNA formují
2. samotná syntéza DNA řetězce podle řetězce RNA prostřednictvím RT transkriptázy
3. odstranění RNA řetězce pomocí RNasy H
4. syntéza druhého vlákna prostřednictvím PCR.
Reakce:
1. Připravte následující směs:
Komponenta (koncentrace zásobního roztoku)
RNA
10mM dNTP
Oligo (dT) - 100 µM
H2O
Množství
10 pg-5µg totální RNA nebo 10pg-500 ng mRNA
1 µl
1 µl
Doplnit do 20 µl
17
Ekotech: Kurz základních metod molekulární biologie: Syntéza cDNA
2. Pro denaturace inkubujte při 65oC, 5 min.
3. Připravte následující směs, přičemž přidávejte komponenty v určeném pořadí:
Komponenta
Množství
10X RT pufr
2 µl
25mM MgCl2
4 µl
0,1M DTT
2 µl
RNase OUT inhibitor nebo nahraďte vodou
1 µl
Dodejte 9 µl této směsi k RNA a primerům, promíchejte, centrifugujte a inkubujte 2 min v 42oC.
4. Ke směsi přidejte 1 µl (50U) SuperScript II RT a inkubujte 50 min při 42oC.
5. Ukončete reakci inkubací v 70oC, 15 min. Zchlaďte na ledu a centrifugujte.
6. Přidejte 1 µl RNasy H a inkubujte v 37oC po 20 min.
PCR S cDNA
Nasyntetizované 1. Vlákno cDNA můžete použít pro PCR za standardních podmínek. Při PCR
se syntetizuje druhé vlákno cDNA.
Poznámky:
1. Jako templát by měla být používaná RNA bez jakékoliv kontaminace genomovou DNA. Při izolaci
RNA se proto doporučuje zahrnout krok s působením DNázy.
2. Pro syntézu cDNA zahrňte také negativní kontrolu, tzn. vzorek, do nějž nebudete dodávat RT
transkriptázu. Pokud vám po PCR v této kontrole vznikne produkt, je to na základě kontaminace,
pravděpodobně genomovou DNA.
18
Ekotech: Kurz základních metod molekulární biologie: Klonování
KLONOVÁNÍ
Klon je soubor molekul nebo buněk, které jsou všechny identické s původní molekulou nebo buňkou.
Klonování genu znamená vytvoření mnoha jeho kopií např. v populaci baktérií, kvasinek, atd.
Technika klonování znamená, že je třeba přimět určité hostitelské buňky, aby kopírovaly cizí vloženou
DNA, kterou po namnožení v těchto buňkách z těchto buněk izolujeme. Namnožený úsek lze použít
pro různé účely, jako např. pro konstrukci chimérických genů, pro výrobu hybridizační sondy, pro in
vitro transkripci, kdy získáváme proteinový produkt kódovaný vloženou molekulou DNA.
Kvůli jednoduchosti a levnosti kultivace a velké rychlosti množení se jako hostitelské buňky pro cizí
klonovanou DNA používají především bakterie, příp. bakteriofágy. V některých případech, kdy je
potřeba množit velké molekuly cizí DNA v celku, se používají také kvasinky. Cizí DNA se vloží do již
předem připravené molekuly, která obsahuje všechny sekvence potřebné ke vstupu, přežití a
množení v určité hostitelské buňce. Taková molekula, která slouží k přenesení cizí DNA do určité
hostitelské buňky, se pak obecně označuje jako vektor. Pokud tento vektor slouží nejen k přenesení
do buňky, ale i k zajištění jejího klonování v buňce, jde o tzv. klonovací vektor.
Jako klonovací vektory se používají plazmidy, fasmidy, bakteriofágy, kosmidy, umělé bakteriální
chromosomy (BAC = bacterial artificial chromosome) a umělé kvasinkové chromosomy (YAC = yeast
artificial chromosome).
•
plazmidy jsou malé molekuly kruhové DNA, které se vyskytují přirozeně v bakteriálních
buňkách. Ve své přirozené podobě obsahují genetickou informaci, která není nutná pro
běžný život hostitelské bakterie, ale může být užitečná v některých životních situacích. Ke
klonování se používají plazmidy geneticky upravené, které jsou dokonale přizpůsobeny
svému účelu. Do plazmidu lze běžně vložit molekulu cizí DNA, jejíž velikost nepřesahuje 10-15
kb, v ideálním případě lze vložit i molekuly kolem 22 kb.
•
fasmidy (angl. phagemid) jsou obecně plazmidy vybavené navíc částí genomu některého
bakteriofága. Nejčastěji jsou používány fasmidy vybavené replikačním začátkem vláknitého
bakteriofága f1, který umožňuje připravit z fasmidu jednovláknovou DNA pro sekvenování.
•
bakteriofágy jsou viry, napadající bakterie. Po genetické manipulaci je lze použít ke klonování
větších molekul DNA (32 - 47 000 párů bází). Infikujeme-li hostitelský kmen bakterie
bakteriofágem s vloženou cizí DNA, dojde v průběhu lytického cyklu k namnožení celé fágové
DNA včetně cizí DNA.
•
kosmidy jsou plazmidy se zabudovanými částmi sekvence bakteriofága l (tzv. cos-sekvence),
která umožňuje efektivní prostorovou organizaci velkých molekul DNA. Výhodně slučují
vlastnosti plazmidů a bakteriofágů - bez zaklonované cizí DNA je lze množit jako plazmidy,
pak je lze použít k zaklonování mnoha tzv. konkatemerů, ve kterých se střídají různé úseky
cizí DNA a kosmidu, tyto částice lze pomnožit v průběhu infekce bakterií podobně jako u
bakteriofágů a pak z lyzátu získat DNA.
•
molekuly cizí DNA větší než 47 000 párů bází lze zaklonovat do umělých bakteriálních nebo
kvasinkových chromosomů. Obsahují sekvence, které zajistí replikaci celého umělého
chromosomu v S-fázi buněčného cyklu hostitelské buňky, a dále sekvence, které plní funkci
centromery při dělení hostitelských buněk v mitóze. Umělé kvasinkové chromosomy jsou
lineární, takže jejich konce musejí být navíc chráněny před degradací telomerami.
19
Ekotech: Kurz základních metod molekulární biologie: Klonování
PLASMIDY A KLONOVACÍ VEKTORY
Plasmidy jsou cirkulární dsDNA přirozeně přítomné v baktériích. Jsou využívány pro experimentální
manipulace s geny a jejich klonování jako tzv. klonovací vektory. Plasmidy používané jako klonovací
vektory obsahují replikátor (počátek
replikace), tj. sekvenci, kterou rozpoznává
DNA polymeráza hostitelské buňky. Dále
obsahují selekční marker, který zajistí
buňkám obsahující vnesený vektor selekční
výhodu nad buňkami, které vektor
neobsaují. Jako selekční geny se nejčastěji
používají geny pro rezistenci k antibiotiku,
většinou
ampicilinu,
méně
častěji
kanamycinu, tetracyklinu, chloramfenikolu,
aj.). Dále je obsaženo klonovací místo (tzv.
polylinker nebo MCS- multiple cloning site,
tj. místo s velkým množství restrikčních
míst, která umožní vložení cizí DNA). Často
také obsahují gen LacZ, který umožní tzv. modro-bílou selekci (viz. dále), umožňující rozlišení buněk
obsahujících prázdný klonovací vektor od vektoru s vloženým inzertem. Ke klonování je komerčně
dostupná celá řada klonovacích vektorů.
Klonování genu se děje v několika krocích:
1. LIGACE: Integrace genu do vektoru
2. TRANSFORMACE: Integrace vektoru do baktérií, tzv. transformací kompetentních buněk
3. KULTIVACE: Namnožení baktérií
4. IDENTIFIKACE KLONŮ:Identifikace klonů, které obsahují naši klonovanou DNA
5. IZOLACE PLASMIDOVÉ DNA: Izolace vektoru s naklonovanou DNA z baktérií
6. OVĚŘENÍ SEKVENCE KLONOVANÉ DNA: Restrikční štěpení a sekvenování
20
Ekotech: Kurz základních metod molekulární biologie: Klonování
INTEGRACE GENU DO VEKTORU
Pro vložení cizí DNA (tzv. insertu) do plazmidu nejprve plasmid linearizujeme (tj. rozštěpíme jeho
kruhovou molekulu). Pro linearizaci se používají restrikční endonukleázy, které štěpí v polylinkeru
vektoru. Tzn., že plasmid rozštěpíme v klonovacím místě některou z restrikčních endonukleáz. Např.
na uvedeném obrázku je vektor, jehož klonovací místo obsahuje restrikční místa pro Not I, EcoR I, Bgl
II, Kpn I, atd. V závislosti na restriktáze, vzniklé konce
mohou být buď tupé („blunt ends“) nebo kohesivní
(„sticky ends“), viz. obr. dole. Konce takto
linearizovaného plasmidu spojíme ligací s konci
vkládaného inzertu. Spojované konce musejí být
kompatibilní, tzn., že v případě kohesivních konců
musí být štěpené stejným restrikčním enzymem. Tupé
konce se naproti tomu spojují s jakýmikoliv jinými
tupými konci. Pro účinnost integrace (tj.ligace) je ale
výhodnější mít kohesivní konce.
Integrace insertu do vektoru se děje tzv. ligací. Ligace se děje prostřednictvím enzymu T4DNA ligázy,
která spojuje volné konce. Pro ligační reakci potřebujeme roztok s rozštěpeným klonovacím
vektorem, roztok insertu, který nese konce kompatibilní ke štěpeným koncům klonovacího vektoru,
ligační pufr, který obsahuje ATP a potřebné soli. Pro úspěšnou ligaci je třeba do reakce dodat vhodný
poměr počtu konců vektoru k počtu konců insertu. Tento poměr zjistíme pomocí tohoto vztahu:
Ligaci můžeme provádět v poměru insert : vektor jako 1:1 nebo 2:1 (v tom případě násobíme
získanou hodnotu dvěma) nebo jako 3:1 (násobíme získanou hodnotu třema).
Ligace se provádí obvykle po dobu 1 hodiny při teplotě 160C nebo přes noc při teplotě 40C.
Speciálním, ale hodně používaným postupem ligování je ligování přímo PCR produktů. V současné
době se používají dva přístupy, jednak na základě rekombinace jako tzv. Topo cloning (firma
21
Ekotech: Kurz základních metod molekulární biologie: Klonování
Invitrogen, rychlé, účinné, ale drahé) a jednak je to TA cloning, na základě ligace polyT a polyA
převisů (např. pGEM od firmy Promega, detailní informace v uvedeném protokolu dále v textu).
INTEGRACE VEKTORU DO BAKTÉRIÍ
Vpravování plasmidů do baktérií se označuje jako transformace. Pro transformaci se používají
speciálně upravené bakteriální buňky, označované jako kompetentní buňky, tj. buňky, které jsou
schopné přijímat cizí DNA. Bakteriální buňky jsou chráněny cytoplasmatickou membránou a
buněčnou stěnou. Speciální kultivace kompetentních buněk umožňuje prostupnost jejich buněčné
stěny. Prostupnost cytoplasmatické membrány se zajistí při samotné transformaci, a to nejčastěji
mírným teplotním šokem (420C). Transformace se provádí jako inkubace plasmidu s kompetentními
buňkami na ledu, která je následována krátkým teplotním šokem (30-90s, 420C), kdy se naruší
cytoplasmatická membrána a plasmidy se začínají integrovat dovnitř do buněk. Poté se buňky
kultivují v tekutém kultivačním médiu při 370C (obvykle 1 hod), v této fázi dochází k regeneraci
cytoplasmatické membrány a množení buněk. Buňky se vysejou na pevné kultivační médium
v Petriho misce s daným antibiotikem a inkubují přes noc při 370C. Na Petriho miskách z každé
kompetentní buňky vyroste jedna kolonie – jeden klon.
SELEKCE
Selekce klonů, které obsahují klonovací vektor od klonů, které vektor nenesou: Klonovací vektory,
tj. plasmidy nesou gen pro rezistenci k danému antibiotiku. Takže na médiu, které obsahuje dané
antibiotikum, rostou pouze ty buňky, které tento vektor obsahují.
Selekce klonů, které obsahují klonovací vektor s inzertem od klonů, které obsahují prázdný
klonovací vektor: Používá se tzv. modro-bílá selekce, kdy se využívá gen LacZ kódující enzym β galaktosidázu. β-galaktosidáza metabolizuje bezbarvou galaktozu X-Gal na 5-bromo-4-chloro-indoxyl,
který dále spontánně oxiduje na modře zbarvený 5,5'-dibromo-4,4'-dichloro-indigo. V klonovacím
vektoru, uvnitř genu LacZ je umístěno klonovací místo. Přítomnost klonovacího místa nenarušuje
funkčnost genu, nicméně funkčnost genu je narušena integrací insertu do tohoto místa, kdy dochází
k porušení čtecího rámce genu LacZ. Pokud tedy pěstujeme
bakterie na médiu obsahující X-Gal, modře zbarvené kolonie
jsou kolonie buněk, jejich plasmid neobsahuje insert, na
rozdíl od bílých kolonií, jejichž plasmid insert obsahuje.
Tento systém je ovšem jenom pomocný, protože do určité
míry selhává. Pomáhá nám ale zúžit soubor kolonií, které
velmi pravděpodobně obsahují plasmid s vloženou DNA. Pro
skutečné ověření, že klony obsahují náš inzert, používáme
PCR nebo restrikční štěpení (viz. dále).
OVĚŘENÍ KLONŮ NESOUCÍCH INZERTNÍ DNA
To, jestli klon je specifický, tzn., jestli obsahuje naši DNA, můžeme ověřit třemi způsoby:
1. Nejjednodušším způsobem jí tzv. Clontest, což je PCR s primery, které jsou specifické pro
klonovaný úsek DNA. Jako templátovou DNA používáme nepatrné množství testované kolonie, které
22
Ekotech: Kurz základních metod molekulární biologie: Klonování
se nabere špičkou a přenese přímo do PCR reakce. Pomocí tohoto testu můžeme poměrně rychle a
levně identifikovat specifické kolonie, aniž bychom předtím museli pracně izolovat plasmidovou DNA
pomocí „miniprepů“ (viz. níže).
2. Pokud již máme izolovanou plasmidovou DNA, specificitu ověřujeme pomocí restrikčního štěpení
s vhodnou kombinací restriktáz, které nám po elektroforetické separaci umožní dle velikosti
klonovacího vektoru a velikosti inzertu identifikovat, jestli klon obsahuje inzert či nikoliv.
3. Sekvenování: je nejbezpečnějším způsobem ověření identity klonů.
V praxi se používají všechny tři způsoby. 1) Pro prvotní identifikaci se na několika koloniích provede
Clontest, což nám umožní určit alespoň několik specifických kolonií. 2) U několika z těchto
specifických kolonií se izoluje plasmidová DNA pomoci tzv. miniprepu. U této DNA se provede
restrikční štěpení. 3) DNA se osekvenuje, a to buď s primery, které jsou specifické k sekvenci
klonovacího vektoru, jako např. T3, T7, SP6 nebo s primery, které jsou specifické k inzertní DNA.
Sekvenování nám jednak prokáže správnou orientaci insertu (v některých experimentech je nutné
mít inzert zaklonovaný v určité orientaci) a také ověří bezchybnou správnost sekvence
zaklonovaného inzertu, což je důležité především v případech, kdy klonujeme PCR produkt, v jehož
sekvenci vlivem nepřesnosti PCR mohou být záměny nukleotidů.
PROTOKOLY
LIGACE
Budeme využívat pGEM vektor od
firmy Promega. Tento vektor obsahuje
poly-T přesahy v klonovacím místě.
Tyto přesahy jsou kompatibilní vůči Apřesahům, které vytváří většina
termostabilních polymeráz během PCR.
Zvyšuje se tak účinnost ligace PCR
produktu do plazmidu a je umožněno
klonování PCR produktů. Vlastní pGEMT vektor nese i gen rezistence vůči
ampicilinu (Amp) a rovněž umožňuje
modro-bílou selekci.
Postup:
Výpočet: pGEM je dodáván v koncentraci 50ng/µl, ale pro úsporu je vhodné si naředit tento vektor
10x tj. na koncentraci 5 ng/µl, která je bohatě dostačující. Množství vektoru a inzertu si vypočítáme
ze vztahu:
23
Ekotech: Kurz základních metod molekulární biologie: Klonování
Velikost pGEM je 3kb o námi připravené koncentraci 5 ng/µl. Koncentrace inzertu je např. 8 ng/µl a
jeho velikost je 800bp tedy 0,8kb. Z uvedeného vzorce vyplývá, že v našich podmínkách, pokud
použijeme 1µl vektoru a připravujeme 10µl reakci, musíme použít 1,3 ng inzertu (při poměru 1:1)
nebo 4 (při poměru 1:3). Např. se rozhodneme dělat ligaci v poměru 1:3.
Reakce :
Komponenta
Množství
H2O
2,5 µl
Insert (8 ng/µl)
0,5 µl
Vektor (5 ng/µl)
1 µl
2X ligační pufr
5 µl
T4 DNA ligáza
1 µl
Celkem
10 µl
Směs promícháme a zcentrifugujeme. Inkubujeme buď přes noc při 40C nebo hodinu při 160C.
TRANSFORMACE
Transformace může být protřednictvím teplotního šoku nebo elektroporací. My uvedeme protokol
pro transformaci buněk DH5α teplotním šokem.
1. Kompetentní buňky vyndáme z -800C. Rozehřejeme buď umístěním na led nebo opatrně v ruce.
Buňky se ale nesmí zahřát příliš! Rovněž s buňkami, protože mají poškozenou buněčnou stěnu,
zacházíme velmi opatrně – netřeseme s nimi, nevortexujeme, necentrifugujeme. Pokud
promícháváme, tak špičkou jejím opatrným kroužením.
2. K 50 µl buněk přidáme 2 µl ligační směsi, jemně promícháme (až 25 ng DNA na 50 μl buněk, objem
DNA nesmí přesáhnout 5% objemu kompetentních buněk)
4. Inkubujeme 30 minut na ledu
5. Provedeme teplotní šok („heat shock“) umístěním zkumavky s buňkami na 90 sekund do 42 °C
6. Zkumavku rychle přemístíme na led a inkubujeme 1-2 minuty.
7. K buňkám přidáme 800-900 μl SOC media nebo LB medium
8. Inkubujeme na třepačce 45-60 minut v 37°C
9. Připravíme kultivační misky s LB/Amp/IPTG/X-Gal:
K rozehřátému pevnému LB médiu, jehož teplota není vyšší než 65°C (jinak by degradoval ampicilin),
přidáme ze zásobního roztoku ampicilin do finální koncentrace 100 µg/ml kultivačního média. Pokud
máme 0,1g/ml zásobní roztok ampicilinu, na jeden mililitr média přidáváme 1 µl ampicilinu. Médium
rozlijeme do misek (cca 25 ml do Petriho misky o průměru 8cm).
24
Ekotech: Kurz základních metod molekulární biologie: Klonování
V 1,5 ml sterilní zkumavce smísíme 64 ul X-Gal (12,5 mg/ml) a 3,5 µl IPTG (240 mg/ml) ze zásobního
roztoku, promícháme a naneseme na povrch pevného média a pomocí sterilní skleněné kultivační
kličky rovnoměrně rozetřeme po povrchu média. Sterilitu získáme namočením kličky do etanolu a
jejím krátkým vypálením nad plamenem.
10. 100 μl buněk rozetřeme sterilní skleněnou kličkou na povrch media.
11. Zbytek buněk centrifugujeme, většinu supernatantu tj. horní fáze odstraníme a ve zbytku
supernatantu (cca 100µl) resuspendujeme buňky. V této fázi, buňky již mají obnovenou buněčnou
stěnu, takže nejsou náchylné k mechanickému poškození. Buňky naneseme na médium.
12. Inkubujeme misky s buňkami přes noc v 370C. Obvykle je inkubační doba 12-16 hodin, ne výrazně
více, jinak baktérie přerostou.
IDENTIFIKACE KLONŮ
Bílé kolonie, které nám narostly, přeneseme „přečárkujeme“ na misku s čerstvým médiem a
necháme růst alespoň několik hodin nebo lépe přes noc.
Provedeme Clontest pro identifikaci specifických kolonií. Tzn. malé, téměř nepatrné množství kolonie
přeneseme špičkou do PCR reakce, která obsahuje primery specifické pro náš zaklonovaný fragment.
Provedeme PCR za standardních podmínek a vyhodnotíme elektroforeticky. Tento test nám určí,
které z bílých kolonií skutečně nesou náš klonovaný fragment.
IZOLACE PLASMIDOVÉ DNA
Izolaci plasmidové DNA označujeme jako izolaci miniprepů (pokud je izolováno jen malé množství
plasmidové DNA), midiprepů (střední množství), maxiprepů (velké množství) a megaprepů (enormně
velké množství). V počáteční fázi ale vždy používáme miniprepů, protože větší množství plasmidu
izolujeme až ve chvíli, kdy máme bezpečně ověřenou sekvenci zaklonovaného fragmentu a
potřebujeme velké množství plasmidu pro uskladnění či další experimenty. Plasmidovou DNA, kterou
skladujeme v -200C můžeme kdykoliv použít pro zpětnou transformaci a izolaci nové plasmidové
DNA.
Pro izolaci plasmidové DNA používáme komerční kity, kterých je na trhu celá řada. Např. firma
Qiagen, Macherey Nagel, Invitrogen. Protože je třeba u těchto kitů dodržovat přesný návod
dodávaný výrobcem, nebudeme zde uvádět žádný podrobný protokol.
RESTRIKČNÍ ŠTĚPENÍ PLASMIDU
Restrikční štěpení plasmidové DNA se provádí za standardních podmínek. Pomocí restrikčního
štěpení můžeme jednak identifikovat specifické klony nesoucí zaklonovaný inzert, jednak ho
používáme pro vyštěpování určitých úseků v zaklonované DNA či vkládání nových úseků do
zaklonované DNA, tj. pro konstrukci chimérické DNA.
SEKVENOVÁNÍ ZAKLONOVANÉHO ÚSEKU DNA
25
Ekotech: Kurz základních metod molekulární biologie: Klonování
Pro sekvenování se často používají primery, které jsou specifické k sekvencím ohraničujícím klonovací
místo. U velké části klonovacích vektorů to jsou primery T3, T7 nebo SP6.
Sekvence těchto primerů jsou: SP6: ATTTAGGTGACACTATAG, T3: GCAATTAACCCTCACTAAAGG,
T7: TAATACGACTCACTATAGGG
26
Ekotech: Kurz základních metod molekulární biologie: PCR
PCR
Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda snadného
zmnožení úseku DNA. Množený (amplifikovaný) úsek DNA je na obou svých koncích ohraničen tzv.
primery, tj. cca 20-25 nt oligonukleotidy. K syntéze nového vlákna DNA se používá termostabilní DNA
polymeráza nejčastěji bakterie Thermus aquaticus, odtud označení Taq polymeráza. PCR probíhá v
zařízení zvaném termocykler, které je zkonstruováno tak, aby dokázalo během několika sekund zvýšit
nebo snížit teplotu o několik desítek stupňů Celsia.
PCR se sestává z několika kroků:
1. Denaturace - DNA se po dobu
20-30 sekund zahřívá na
teplotu 94-98 °C. Při této
teplotě dochází k rozrušení
vodíkových můstků v molekule
DNA
a
k
rozvolnění
dvoušroubovice. Vzniká tak
jednovláknová DNA, na kterou
mohou
v
dalším
kroku
nasednout primery.
2. Nasednutí primerů - teplota se
sníží na 50-65 °C, což umožňuje
nasednutí primerů na specifická
místa DNA. Na dvouvláknové
úseky DNA-primer se váže DNA
polymeráza.
3. Syntéza DNA - teplota použitá v
této fázi závisí na použité DNA
polymeráze. Nejběžnější Taq
polymeráza
má
optimum
aktivity na 72-80 °C. V tomto
kroku dochází k samotné
syntéze DNA. Ve směru od 5'
konce ke 3' konci přirůstá
vlákno DNA komplementární k
původní molekule DNA.
Tyto kroky se cyklicky opakují, pro dostatečnou amplifikaci původní molekuly DNA obvykle postačuje
30 cyklů. V případě, že na začátku byla ve vzorku pouze jediná molekula DNA, po 32 cyklech
teoreticky dostaneme až 1 miliardu nasyntetizovaných molekul DNA.
PRIMERY
Navržení primerů: Navržení primerů je jedním z klíčových okamžiků pro správný výsledek PCR. Pro
standardní PCR navrhujeme primery v párech – tzv. „forward“ primer a „reverse“ primer (viz. dále).
Primery můžete navrhnout pomocí některého ze softwarů volně dostupných na internetu nebo je
můžete navrhnout „ručně“.
27
Ekotech: Kurz základních metod molekulární biologie: PCR
Délka a sekvence primerů: Primery jsou obvykle 20-25 nt dlouhé, primery v daném páru musí mít
srovnatelný počet GC:AT párů. Upřednostňujeme primery s 50-60% obsahem GC nebo AT párů.
Sekvence mezi oběmi primery nesmí být výrazně komplementární, protože by se primery v reakci
párovaly mezi sebou a méně by nasedaly ke komplementární
sekvenci v templátové DNA (vznik tzv. dimerů). Rovněž nesmí
vzniknout komplementarita v rámci sekvence u jednoho
z primeru, kdy by došlo ke vzniku vlásenky (viz. obr.) či jiných
sekundárních struktur a primer by tak nefungoval. Vždy je bezpodmínečně nutné, aby nasedání
primerů bylo bezchybné alespoň v 3’ oblasti primeru.
Primery se vždy navrhují podle sekvence horního vlákna, tj. sekvence, která se při běžném zápisu
DNA používá. Sekvence forward primeru je totožná se sekvencí horního vlákna. Forward primer
umožňuje syntézu horního vlákna podle templátového spodního vlákna.
Reverse primer se navrhuje jako komplementární sekvence k hornímu vláknu, která je navíc
v reverzní orientaci. Reverse primer umožňuje syntézu dolního vlákna podle templátového horního
vlákna.
Teplota nasedání primerů (teplota „annealingu“): Od délky primerů a počtu GC párů se odvíjí
teplota nasedání primerů. Čím větší délka a vyšší obsah GC párů, tím je teplota nasedání vyšší (viz.
přiložená tabulka). Teplota nasedání primerů musí být dostatečně vysoká, aby nedošlo
k nespecifickému nasedání primerů k templátové DNA, pokud by ale byla příliš vysoká, primery by
nenasedaly vůbec. Z toho důvodu je třeba, aby teplota nasedání byla optimální pro oba primery a
obsah GC párů v obou primerech byl srovnatelný, tzn. aby byla srovnatelná teplota nasedání obou
primerů. Pro výpočet teploty primerů můžete použít některý ze softwarů volně dostupný na
internetu nebo můžete použít níže přiloženou tabulku.
Ředění primerů: Primery přicházejí od výrobce v lyofilizovaném (vysušeném) stavu. Zkumavku
s primerem nejprve krátce centrifugujeme a poté primer naředíme na koncentraci 100pmol/µl (tj.
0,1mM). Pro ředění používáme sterilní miliQ vodu, zásadně používáme špičky s filtrem. Množství
vody se odvíjí od množství primeru, které bylo nasyntetizováno a které je definováno množstvím
molů v protokolu, který výrobce zasílá spolu s primerem. Např. pokud je výtěžek 21,9 nmol, toto
množství rozpustíme v 219µl vody a získáme tak 0,1mM roztok. Při ředění primeru postupujeme tak,
že do zkumavky s primerem napipetujeme dané množství vody, zkumavku uzavřeme a důkladně
zvortexujeme. Získáme tak 0,1mM (100 pmol/µl) zásobní roztok primeru. Tento roztok dále ředíme
10x, tj. do 99 µl vody přidáme 1µl zásobního roztoku. Získáme tak 10µM (10pmol/µl) pracovního
roztoku. Roztoky s primery jsou skladovány v -200C.
28
Ekotech: Kurz základních metod molekulární biologie: PCR
bp
16
17
18
19
20
21
22
23
24
25
6
39
43
45
47
49
51
53
55
57
59
7
41
45
47
49
51
53
55
57
59
61
Teplota nasedání primerů pro daný počet bazí a GC párů
Počet GC párů
8
9
10
11
12
13
14
15
43
25
47
49
51
53
55
57
47
49
51
53
55
57
59
61
49
51
53
55
57
59
61
63
51
53
55
57
59
61
63
65
53
55
57
59
61
63
65
67
55
57
59
61
63
65
67
69
57
59
61
63
65
67
69
71
59
61
63
65
67
69
71
73
61
63
65
67
69
71
73
75
63
65
67
69
71
73
75
77
16
59
63
65
67
69
71
73
75
77
79
17
18
65
67
69
71
73
75
77
79
81
67
71
73
75
77
79
81
83
OBJEM A SLOŽENÍ REAKCE
Objem reakce: ve většině případů se reakce připravuje v 25µl, ale může se připravovat i v jiných
objemech jako 50µl nebo 100µl. V některých případech, jako je třeba Clontest, kdy testujeme velké
množství vzorků a chceme šetřit Taq polymerázou a postačuje menší množství produktu, můžeme
reakci provádět i v 12 µl.
Složení reakce: Reakci tvoří tyto komponenty:
Templátová DNA: množství templátové DNA může být nepatrné, příliš velké množství DNA naopak
způsobuje v reakci problémy, jako např. nespecifické nasedání primerů.
Primery: obvyklá koncentrace každého z primerů v reakci je 0,1-1 µM (tj. 0,1-1pmol/µl). Tzn., pokud
máme připravený pracovní roztok 10pmol/µl (tj. 10µM) (viz. část o ředění primerů), pro 25µl reakci
použijeme 0,25-2,5µl z obou primerů. Množství primerů musí být optimální. Příliš vysoká
koncentrace vede k nespecifickému nasedání primerů na templátovou DNA nebo párování primerů
navzájem. Příliš nízká koncentrace primerů může vést k nedostatečnému množství produktu.
dNTP směs: obvyklá koncentrace každého dNTP v reakci je 200µM (0.2mM). Množství použité dNTP
směsi se odvíjí od koncentrace zásobního roztoku. Většinou je zásobní roztok dNTP směsi o
koncentraci 10mM pro každý dNTP. Tedy pokud připravujeme 100 µl PCR reakci, použijeme 2 µl
10mM dNTP, u 25µl reakce použijeme 0,5µl dNTP.
MgCl2 : obvyklá koncentrace je 1,5mM. MgCl2 je nutná pro procesivitu a přesnost Taq polymerázy.
Koncentrace MgCl2 se odvíjí od koncentrace dNTP a platí, že pro specificitu reakce koncentrace
MgCl2 musí převyšovat koncentraci dNTP. Pokud máme koncentraci jednotlivých dNTP 200, 400, 600
nebo 800 µl, koncentrace MgCl2 musí být 1.5, 2, 3, 4 nebo 5mM. Nicméně poměr MgCl2 /dNTP lze
v určitých případech pozměňovat (viz. odstavec o reakčních problémech), kdy pro zvýšení specificity
reakce zvyšujeme koncentraci MgCl2 a to až k 5mM přičemž koncentraci dNTP držíme stále na např.
1,5mM. Někteří výrobci Taq polymerázy dodávají MgCl2 zahrnuté do reakčního pufru.
Reakční pufr: obvyklé složení je 50 mM KCl and 10 mM Tris-HCl, pH 8.3. Reakční pufry jsou dodávány
spolu s Taq polymerázou jako 10x koncentrované. Tzn. pro 25µl reakci použijeme 2,5µl dodaného
pufru. Reakční pufr dodá reakci potřebnou koncentraci solí a potřebné pH. Koncentrace solí
29
Ekotech: Kurz základních metod molekulární biologie: PCR
ovlivňuje specificitu reakce, protože ovlivňuje specificitu nasedání primerů. U některých výrobců
reakční pufr obsahuje i 1,5mM.MgCl.
H2O: voda musí být sterilní, pokud možno miliQ. Vodou doplňujeme reakci na požadovaný objem.
Všechny komponenty jsou skladovány v -200C.
SAMOTNÁ REAKCE
Reakce se obvykle provádí ve 30 cyklech. Každý cyklus je tvořen denaturací, nasedáním primerů a
extensí. Cyklickou reakci předchází úvodní denaturace a ukončuje závěrečná extenze.
Obecně: ÚVODNÍ DENATURACE [DENATURACE-NASEDÁNÍ PRIMERŮ-EXTENSE]30X ZÁVĚREČNÁ EXTENSE
Úvodní dentaturace: je důležitá především u genomové DNA, kdy tato úvodní denaturace, protože je
dostatečně dlouhá, zajistí, že vlákna DNA jsou pro reakci plně rozpletena.
Denaturace: 950C, 0,5-1min
Nasedání primerů („annealing“) – teplota závisí na sekvenci primerů (viz. přiložená tabulka). Doba
nasedání je obvykle 30s, ale může se dle potřeby měnit. Zvýšením doby nasedání primeru můžeme
zvýšit výtěžek reakce, ale zároveň také můžeme snížit specificitu nasedání primerů.
Extense: 720C, délka závisí na rychlosti polymerázy (informace od výrobce) a délce produktu. Obvykle
pokud je délka produktu 100-800 bp, extense je 30s, do 1,5kb extense je 1 min.
Závěrečná extense: 4min, 720C. Tato fáze zajistí, že všechny produkty jsou plně dosyntetizovány.
Reakce se obvykle zapisuje v tomto zápisu:
950C, 3min[(950C, 30s)-(580C, 30s)-(720C, 60s)]30x720C, 4min
PŘÍPRAVA REAKCE
Reakci připravujeme na ledu, tzn. všechny komponenty a reakční směsi máme na ledu, kromě Taq
polymerázy. Taq polymerázu máme buď ve speciálním stojánku, který udržuju teplotu okolo -200C
nebo ji vyndáme z mrazničky těsně před použitím a umístíme ji na led.
Používáme preferenčně špičky s filtrem pro zamezení kontaminace.
Používáme negativní a pozitivní kontrolu, pokud je to možné.
Pokud připravujeme více vzorků, připravíme si tzv. „master mix“. Tzn., pokud připravujeme 25µl
reakcí pro deset různých vzorků DNA, reakční směs si namícháme najednou pro všechny vzorky
kromě DNA. Vždy počítáme s jednou reakcí navíc (někdy se stane, že kvůli nepřesnosti pipetováni pro
poslední vzorek není dostatek reakční směsi). Takže např. místo 1 µl primeru přidáme 11µl primeru,
místo 2µl dNTP směsi přidáme 22µl dNTP směsi, atd. Výslednou směs důkladně zvortexujeme a
rozpipetujeme do připravených PCR zkumavek, do kterých poté přidáme testovanou DNA. Reakce
máme stále na ledu.
30
Ekotech: Kurz základních metod molekulární biologie: PCR
Zapneme a naprogramujeme cycler a vložíme vzorky.
Příklad přípravy PCR reakce:
Komponenta (koncentrace)
H2O
Templátová DNA
50mM MgCl2
10x PCR pufr
Primer 1 (10µM)
Primer 2 (10µM)
dNTP mix (10mM)
Taq DNA polymeráza (5U/µl)
CELKEM
Komponenta (finální koncentrace)
18,6 µl
0,5 µl
0,75 µl (1,5mM)
2,5 µl (1x)
1 µl (0,4 µM)
1 µl (0,4 µM)
0,5 µl (0,2 mM)
0,125 µl (0,2U/ µl)
25µl
PROBLÉMY S PCR
Produkt v negativní kontrole: Způsobeno kontaminací buď při přípravě reakce nebo kontaminací
přímo v některé chemikálii.
Žádný nebo slabý produkt:
1. Snižte teplotu nasedání primerů
2. Zvyšte koncentraci primerů nebo množství templátové DNA nebo Taq polymerázy.
3. Změňte koncentraci KCl. Zvyš koncentraci pokud očekávaný produkt je kratší než 1kb nebo
koncentraci snižte pokud očekávaný produkt je delší než 1kb.
4. Přidejte BSA na koncentraci 0,1-0,8 µg/µl
5. Zkontrolujte správnost sekvence primerů.
6. Můžete zkusit kombinaci bodů 1-5.
Dlouhé nespecifické produkty:
1. Snižte čas nasedání primerů
2. Zvyšte teplotu nasedání primerů
3. Snižte čas extense
4. Snižte teplotu extense na 62-680C.
5. Zvyšte koncentraci KCl 1,2x-2x, ale zachovejte koncentraci MgCl2 na 1,5-2mM.
6. Zvyšte koncentraci MgCl2 na 3-4,5 mM ale zachovejte koncentraci dNTP stejnou.
7. Použijte méně primerů nebo templát nebo Taq polymerázy
31
Ekotech: Kurz základních metod molekulární biologie: PCR
8. Kombinujte body 1-7
Krátké nespecifické produkty:
1. Zvyšte čas nasedání primerů
2. Zvyšte teplotu nasedání primerů
3. Zvyšte čas extense
4. Zvyšte teplotu extense na 62-680C.
5. Snižte koncentraci KCl 0,7-0,8x, ale zachovejte koncentraci MgCl2 na 1,5-2mM.
6. Zvyšte koncentraci MgCl2 na 3-4,5 mM ale zachovejte koncentraci dNTP stejnou.
7. Použijte méně primerů nebo templát nebo Taq polymerázy
8. Kombinujte body 1-7
32
Ekotech: Kurz základních metod molekulární biologie: Southernova hybridizace
SOUTHERNOVA HYBRIDIZACE
Southernův přenos (resp. Southern blot či Southern blotting) a Southernova hybridizace je
biochemická hybridizační metoda využívaná při práci s DNA. Vyvinul ji Edwin Southern. Umožňuje
přenos fragmentů DNA z agarového gelu, v němž probíhala elektroforéza, na nitrocelulózovou nebo
nylonovou membránu. Přenesená DNA je na membráně vizualizovaná díky hybridizaci s radioaktivně
nebo fluorescenčně značenou sodnou. Obdobou Southernovy hybridizace je Northern hybridizace,
kdy přenášeným a hybridizovaným vzorkem je RNA.
Celý proces se sestává z těchto kroků:
Elektroforetické separace DNA,
Příprava DNA k hybridizaci: denaturace a neutralizace DNA
Přenos DNA na membránu: kapilárním přenosem je DNA z gelu přenášena na membránu
UV crosslinking: Kovalentní uchycení DNA na membránu pomocí UV
Příprava sondy: sondy jsou buď značeny přímo např. radioaktivně nebo nepřímo. Nepřímo značené
sondy jsou např. sondy s navázaným digoxigeninem, který je pak detekován chemiluminiscenčně.
Hybridizace DNA se sondou: hybridizace se provádí nejčastěji v hybridizačních válcích v hybridizační
peci
Promývání nespecificky navázané sondy
Detekce sondy: Radioaktivní sondy či jinak přímo značené sondy jsou detekovány ihned po promytí.
U nepřímo značených sond je třeba ještě udělat dodatečnou vizualizaci sondy.
V našem případě uvádíme kompletní protokol pro hybridizaci se sondou značenou DIGem. Takto
značená sonda je detekována chemiluminiscenčně.
ELEKTROFORETICKÁ SEPARACE FRAGMENTŮ GENOMOVÉ DNA
Připravit agarózový gel (asi 15 cm dlouhý) v 1x TAE pufru.
Připravit DIG-marker: smíchat 4 µl DIG-markeru + 12 µl NF H 2 O + 4 µl Loading buffer a inkubovat 10
min při 65°C, pak krátce centrifugovat.
Nanést vzorky naštěpené DNA (obvykle 1 μg / line) a DIG -marker (10 µl na každou stranu vzorků) do
jamek a nechat běžet gel při 5 V/cm v 1x TAE pufru po 2-4 h (až je bromphenolová modř asi 10 cm od
startu).
Lehce obarvit ethidium bromidem a rychle vyfotit (dlouhá expozice UV záření ničí DNA). Tento krok
slouží k tomu, abychom se ujistili, ze DNA je dobře naštěpená a její koncentrace v jednotlivých
jamkách je přibližně stejná.
33
Ekotech: Kurz základních metod molekulární biologie: Southernova hybridizace
SOUTHERN BLOTTING
DENATURACE DNA
[Varianta s kapilárním přenosem a inkubací s HCl kvůli degradaci dlouhých fragmentů DNA, příliš
dlouhých pro kapilární přenos; všechny inkubační kroky provádět za mírného třepání.]
1. Ponořit gel do 0.25 M HCl na 10 min (až se modrá barva bromfenolové modře změní na žlutou). Při
tomto kroku se DNA fragmentuje na menší kusy, které jsou schopné přelézt na membránu.
2. Opláchnout gel 2x destilovanou vodou.
3. Ponořit gel do denaturačního roztoku na 2x 15 min při RT.
4. Opláchnout gel 2x destilovanou vodou.
5. Ponořit gel do neutralizačního roztoku na 2x 15 min při RT. Zároveň začít připravovat sendvič
Doporučení: používat rukavice bez pudru a membránu přenášet pinzetou za okraje! Pro lepší
orientaci po hybridizaci je vhodné odstřihnou jeden z rohů gelu.
TRANSFER DNA NA MEMBRÁNU
- s použitím 20x SSC zvlhčit filtrační papír, pomocí kterého připravíme můstek. Zvlčený papír
položíme na stojánek, kterým může být např. krabička otočená dnem vzhůru. Stojánek s filtračním
papírem umístíme do větší misky, tak aby filtrační papír dosahoval po svém obvodu na dno misky.
Z pod filtračního papíru odstraníme případné bubliny, např. skleněnou tyčinkou. Na filtrační papír
umístíme gel, a to vrchní stranou vzhůru (jamky dnem vzhůru). Odstraníme bubliny, které se
případně vytvořily pod gelem. Zalijeme trochou 20xSSC.
- obložit (ale nepřekrýt) gel kusy parafilmu či folie (parafilm má zabránit případnému vzlínání pufru
mimo gel a membránu)
- na gel položíme nylonovou membránu
Hybond N+ (předvlhčenou
vodou),
která přesahuje v obou rozměrech
velikost gelu o 1mm a má také ustřižený
jeden z rohů, položit na gel tak, aby se
oba ustřižené rohy překrývaly. Opět
odstraníme bubliny.
- Na nylonovou membránu položíme 2x
filtrační papír (předvlhčený v 20x SSC)
se stejným rozměrem jako gel
- poté položíme 6-10cm vrstvu buničiny
nastříhané podle rozměru gelu
- přiložíme rovnou desku (sklo) a zatížíme přibližně 500g.
34
Ekotech: Kurz základních metod molekulární biologie: Southernova hybridizace
Do misky nalít 20x SSC tak, aby hladina byla pod horním okrajem stojánku a nechat působit nejméně
6 h, ale je lepší nechat přes noc - více než 15 h).
PROMYTÍ MEMBRÁNY A UV CROSSLINKING
Rozebereme sendvič a překlopíme membránu s gelem na suchý filtrační papír (gelem nahoru).
Popisovačem či měkkou tužkou propiš jamky na gelu na membránu (to je důležité pro budoucí
orientaci membrány – čili kde je nahoře a kde dole).
Odstranit gel z membrány a membránu opláchnout 5 min v 6x SSC (kvůli úplnému odplavení zbytků
gelu).
Membránu necháme okapat a položíme na suchý filtrační papír. Suchou membránu fixujeme ve
Stratagene UV crosslinkeru (přednastavená hodnota - 120 mJ) nebo membránu zapéčeme (20 min při
120°C; pokud nitrocelulózová membrána - zapéct 1 hod při 80°C). Pozitivně nabitou nylonovou
membránu teoreticky není potřeba fixovat, ale stejně to každý dělá).
Opláchnout membránu v 2x SSC.
Pokud se nebude hned provádět hybridizace a chemoluminiscenční detekce, nechat membránu
uschnout, ještě trochu vlhkou zabalit do folie a skladovat +4°C.
HYBRIDIZACE
Vytemperujeme 25 ml DIG Easy Hyb na 42°C.
Pro prehybridizaci ponoříme membránu do 18 ml předehřátého DIG Easy Hyb a inkubujemet 30-60
min při 42°C za mírného třepání.
Hybridizační roztok:
- smíchat 50 ng (1,5 μl) sondy s 50 µl vody a denaturovat 5 minut v 95°C. Pak rychle zchladit na ledu.
Sondu napipetovat do 6,5 ml předehřátého DIG Easy Hyb a promíchat (sondu nikdy nepipetovat
přímo na membránu, protože by se tím zvýšilo pozadí).
Odstraníme beze zbytku prehybridizační roztok (prehybridizační roztok lze používat opakovaně) a
ihned zalít membránu hybridizačním roztokem.
Inkubujeme nejméně 3 h při 42°C za mírného třepání.
Odstraníme hybridizační roztok.
35
Ekotech: Kurz základních metod molekulární biologie: Southernova hybridizace
Promyjeme membránu dostatečným množstvím “Stringent wash buffer I” 2 x 5 min při RT za mírného
třepání.
Promyjeme membránu dostatečným množstvím předehřátého “Stringent wash buffer II” po 15-20
min při 68°C ve vodní lázni za mírného třepání.
CHEMILUMINISCENČNÍ DETEKCE
Promýváme membránu ve 100 ml čerstvě připraveného “1x Washing buffer” 1-5 min při RT za
mírného třepání.
Inkubujeme ve 100 ml čerstvě připraveného “1x Blocking solution” 30 min při RT za mírného třepání.
Inkubujeme v 50-100 ml pracovního roztoku Anti-DIG-AP 30 min při RT za mírného třepání.
Promýváme membránu 2 x 15 min ve 200 ml “1x Washing buffer” při RT za mírného třepání.
Inkubujeme ve 100 ml “1x Detection buffer” 2-5 min při RT za mírného třepání.
Odstraníme detekční pufr a očistíme membránu od zbytků kapaliny položením na filtrační papír
(strana s DNA vzorky nahoře). Membrána nesmí uschnout!
Ihned položit vlhkou membránu (strana s DNA vzorky nahoře) na otevřenou spodní stranu
hybridizačního sáčku a rychle nanést na membránu 40 kapek (asi 3 ml) roztoku substrátu.
Ihned přikrýt svrchní stranu hybridizačního sáčku tak, aby se rovnoměrně a bez bublin rozptýlil
substrát.
Inkubujeme membránu 5 min až hodinu při RT.
Vymačkáme nadbytečný substrát a uzavřít okraje hybridizačního sáčku lepící páskou.
Výsledek dokumentujeme pomocí CCD kamery LAS-3000.
CHEMIKÁLIE A ROZTOKY
DIG-DNA markery: DNA Molecular Weight Markers, DIG-labeled (Roche) podle potřeby
Membrána: Hybond-N+ (Amersham Biosciences) cat. RPN203B
Prehybridizační a hybridizační roztok: DIG Easy Hyb (Roche) cat. 11 796 895 001
36
Ekotech: Kurz základních metod molekulární biologie: Southernova hybridizace
Detekce: DIG Wash and Block Buffer Set (Roche) cat. 11 585 762 001
Protilátka k DIG značené sondě: Anti-Digoxigenin-AP, Fab fragments (Roche) cat. 11 093 274 910
Chemoluminiscenční substrát: CDP-Star ready to use (Roche) cat. 11 759 051 001
PŘÍPRAVA PRACOVNÍCH ROZTOKŮ
Solution
Content
Preparation
1x TAE buffer
0.04 M Tris-acetate, 0.001 M EDTA, ph 8.0. Nařeď z 50x TAE 1:49.
Store
RT
Příprava 50x TAE: 242 g Trizma base v 500 ml H2O, přidej 100 ml 0.5 M
Na2EDTA (pH 8.0), doplň na 1 litr.
HCl sol.
0.25 M HCl
Na 200 cm2 membrány asi 250 ml.
Denaturation sol. 0.5M NaOH, 1.5 M NaCl
Na 200 cm2 membrány asi 500 ml.
Neutralization sol. 0.5 M Tris-HCl, 3M NaCl, pH 7.5
Na 200 cm2 membrány asi 500 ml.
20x SSC
24 ml 35% HCl (10.7 M) + 1000 ml RT
H2O
20 g NaOH + 87.66 g NaCl rozpustit RT
v H2O a doplnit na 1000 ml
63.5 g Trizma HCl + 11.8 g Trizma RT
Base + 175.33 g NaCl rozpustit v
H2O a doplnit na 1000 ml
3 M NaCl, 0.3 M Sodium citrate, pH 7.0
RT
Příprava 20x SSC: 175.32 g NaCl + 88.32 g Tri-Natrium citrate Dihydrate
rozpustit v H2O a doplnit na 1000 ml => upravit na pH 6.4 (1 N HCl) - 2x
SSC bude mít pH 7.0.
2x SSC
Nařeď dle potřeby z 20x SSC 1:9
RT
Stringent
buffer I
wash 2x SSC, 0.1% SDS
Pro 500 ml roztoku: 50 ml 20x SSC RT
+ 5 ml 10% SDS + 445 ml H2O
Stringent
buffer II
wash 0.2x SSC, 0.1% SDS
Pro 500 ml roztoku: 5 ml 20x SSC + RT
5 ml 10% SDS + 490 ml H2O
Washing buffer
1x
Maleic acid
1x
Nařeď dle potřeby z 10x Washing RT
buffer 1:9 (celkem 300ml)
Nařeď dle potřeby z 10x Maleic NE!
acid buffer 1:9 (celkem 180 ml)
37
Ekotech: Kurz základních metod molekulární biologie: Southernova hybridizace
Blocking sol.
1x 1x
Anti-DIG-AP
working sol.
Detection buffer
1x
Nařeď Blocking buffer 1x Maleic RT
acid” pufrem 1:9 (t.j. 180ml MA +
20ml Blocking buffer)
Naředit přiměřené množství 1x blokovacím roztokem na finální NE!
koncentraci 75 mU/ml (tj. 1:10000 t.j. 1µl/10ml). (celkem 50-100ml)
Nařeď dle potřeby z 10x Detection RT
buffer 1:9 (celkem 100 ml)
38
Ekotech: Kurz základních metod molekulární biologie: Western blot WESTERN BLOT Western blot je analytická technika používaná k detekci specifického proteinu ve směsi s dalšími proteiny, např. ve vzorku homogenátu tkáně či jiného biologického vzorku. Nejběžněji typem je SDS‐PAGE (SDS polyacrylamide gel electrophoresis). V přítomnosti SDS dochází k denaturaci proteinů a zároveň SDS dává proteinům záporný náboj. Tímto jsou při elektroforéze proteiny děleny podle své hmotnosti (udává se v kDa). Malé protein cestují sítí akrylamidového gelu rychleji, proteiny o velké molekulové hmotnosti se pohybují směrem k anodě pomaleji. Vzorky jsou nanášeny na gel do jamek, z toho jedna lajna je ponechána pro tzv. ,,Size marker“, neboli řebříček. Jedná se o komerčně dostupnou směs proteinů o známé velikosti, které jsou již značené a tedy viditelné. 39 Ekotech: Kurz základních metod molekulární biologie: Western blot Aby se proteiny mohly detekovat pomocí protilátky, nejprve se musí přenést z gelu na povrch nitrocelulosové, v dnešní době vice používané polyvinylové (PVDF) membrány. Tato metoda se jmenuje elektroblot. Působením elektrického proudu dochází k přenosu proteinů z gelu na povrch membrány. Protože elektrické pole působí kolmě na rovinu gelu, jsou proteiny přeneseny na membránu ve stejné orientaci. Membrány mají vlastnost, že nespecificky vážou všechny proteiny. Avšak jak protilátky, tak detekované antigeny jsou proteiny, to znamená, že nespecifické vázání protilátky by dávalo falešný výsledek. Z tohoto důvodu se musí zabránit interakci membrány a protilátky. Po elektroblotu se membrána nejprve blotuje v roztoku nějaké komerčně dostupné směsi proteinů. Nejčastěji se používá 3‐5 % Bovine Serum Albumin (BSA) nebo non‐fat dry milk, společně s malým množstvím slabého detergentu (Tween 20 nebo Triton X‐100). Tímto se zaplní volná místa na membráně a protilátka se může vázat pouze na svůj specifický antigen. Protilátková detekce proteinů se obvykle provádí ve dvou krocích. Při imunizaci zvířete antigenem (protein našeho zájmu) dochází k tvorbě specifických protilátek, které rozeznávají antigen nebo jeho určitou část. Následně se imunitní buňky produkující protilátku kultivují a protilátka se purifikuje. Po vysycení membrány se membrána inkubuje s primární protilátkou. Roztok je vždy složen z 1x PBS opět s přídavkem BSA nebo mléka a detergentu. Po skončení je třeba membránu zbavit nenavázané primární protilátky. V dalším kroku je membrána inkubována v sekundární protilátce. Ta se vyrábí imunizací zvířete jiného druhu, než ve kterém byla připravena primární. Jako antigen se používá část primární protilátky. Například když je primární protilátka králičí, sekundární může být připravena v myši. Sekundární protilátka je označena nějakou značkou (biotin) nebo konjugována s nějakým reportérovým enzymem umožňující vizualizaci ‐ např. peroxidásou (HRP, z angl. horseradish peroxidase) či alkalickou 40 Ekotech: Kurz základních metod molekulární biologie: Western blot fosfatasou (AP, z angl. alcalic phosphatase). Výhodou tohoto dvou stupňového procesu je amplifikace signálu (na jednu primární protilátku se váže vice sekundárních). Po odstranění volné protilátky můžeme detekovat protein na membráně. Hojně užívaný je chemiluminiscenční způsob: reportérový enzym (peroxidása) přeměňuje chemilumiscenční substrát na nestabilní produkt, který se stabilizuje vyzářením kvanta světla. Množství světla je poté úměrné množství peroxidásy, které je přímo úměrné množství daného proteinů. Uvolňované světlo je pak detekováno použitím CCD‐kamer. V praxi se však mnohdy setkáváme s dalšími proužky na membráně (tzv. falešná pozitiva). Pro určení správného bandu nám může posloužit marker molekulových vah. Pro kvantifikaci je dobré opakovat blotování membrány za použití protilátky proti strukturnímu proteinu (aktin nebo tubulin). Množství těchto proteinů by mělo být stejné u všech vzorků, pokud byly naneseny rozdílné množství vzorků, nebo u některých došlo k špatnému přenosu z gelu na membránu, můžeme za použití strukturálních proteinů provést normalizaci. 41 Ekotech: Kurz základních metod molekulární biologie: Western blot PROTOKOL
Potřebné roztoky
Separating Buffer
1.5 M Tris-HCl, 0.4 % SDS, pH 8.8
Stacking Buffer
0.5 M Tris-HCl, 0.4 % SDS, pH 6.8
Acrylamide / Bis-Acrylamide poměr 29 : 1
APS 10 %
10x PBS
80 g NaCl
2 g KCl
14.4 g Na2HPO4
2.4 g KH2PO4
Rozpusť v 800 ml dH2O, uprav pH na 7.4, doplň do 1000 ml.
1x Ponceau S
Ponceau S 2% (w/v)
TCA 3% (w/v)
(dá se použít vícekráte).
10x Running Buffer
30.3 g (0.25 M) Tris Base
144 g (1.92 M) Glycine
10 g (1%) SDS
qs 1000 ml dH2O.
10x Electrotransfer Buffer
30.3 g Tris Base
144 g Glycine
qs 1000 ml ddH2O
1x Electrotransfer Buffer
100 ml 10x Electrotransfer Buffer
200 ml methanol
700 dH2O
SDS-PAGE Gel a Western Blot.
1. Příprava gelu (10 %)
Separační gel
Smícháme
ddH2O
6.25 ml
42 Ekotech: Kurz základních metod molekulární biologie: Western blot AA : bisAA
4.99 ml
Separating Buffer
3.75 ml
Zahřejeme v mikrovlnce, prudce zchladíme na ledu.
Přidáme
10 % APS
112
ul
Temed
11.25 ul
Nalijeme gel (zastavíme 1 cm pod hřebínkem), přelijeme 100% izopropanolem
Stacking gel
Smícháme
ddH2O
4.5
ml
AA : bisAA
1.05 ml
Stacking Buffer
1.88 ml
Zahřejeme v mikrovlnce, prudce zchladíme na ledu.
Zatím vylijeme izopropanol a opláchneme gel dH2O, osušíme filtračním papírem.
Přidat
10 % APS
Temed
Nalijeme gel, vsuneme hřebínky
30 ul
10 ul
2. Naneseme vzorky na gel, 10 ul / jamku (pozor nedávat moc vzorku).
3. Necháme běžet SDS-PAGE dokud modrá barva nebude vespod gelu.
Podmínky elektroforézy:
60 V 30 min
90 V cca 2h (modrá barva vespod zastav)
4. Transfer: Přenos z gelu na PVDF membránu.
Namočíme membránu v 100% methanolu 20 sec
ddH2O 2 min
1x transfer buffer 5 min.
Sestavíme aparaturu v následujícím pořadí:
svorka (černá strana)
houba
Whatmanův papír
 gel
 membrána
Whatmanův papír
houba
svorka (bílá strana)
Vložíme do přenosové aparatury, černá strana úchytu sousedí s černou aparatury.
43 Ekotech: Kurz základních metod molekulární biologie: Western blot Electrotransfer:
35-40 V, přes noc (chladíme pomocí chladícího gelu)
5. Ponoříme do 1x Poncea S po dobu 5 min, poté odbarvíme použitím kyselé dH2O.
6. Blotujeme membránu 1-3 h. v 1x PBS + 5% non-fat dry milk + 0.05%
Tween 20, zavaříme do plastického sáčku.
Membrána nesmí uschnout!!!
7. Promyjeme 3 x 5 min v 1x PBS + 0.05% Tween 20
8. Inkubujeme s primární protilátkou (ředění 1 : 1000 v 1x PBS + 5% milk + 0.05%
Tween 20. Inkubujeme 1 h. při 4ºC). Zavaříme do plastického sáčku.
9. Promyjeme 3 x 5 min v 1x PBS + 0.05% Tween 20 za pokojové teploty
10. Inkubujeme v 1x PBS + 10% milk + 0.05% Tween 20 po dobu 10 min.
11. Inkubujeme se sekundární protilátkou (ředění 1 : 5000, po dobu 30 min za pokojové
teploty v 1x PBS + 5% milk + 0.05% Tween 20). Zavaříme do plastického sáčku.
12. Promyjeme 3 x 5 min v 1x PBS + 0.05% Tween 20 za pokojové teploty
.
13. Detekujeme proteiny pomocí Thermo Super Signal kit (2 ml / membránu). V čisté
falkonce smícháme tmavý a světlý ECL roztok v poměru 1 : 1. Osušíme membránu na
filtračním papíru, naneseme ECL roztok a 5 min. inkubujeme zabalený v plastiku,
zakryjeme před světlem. Osušíme membránu na filtračním papíru, zabalíme do plastiku a
detekujeme pomocí CCD kamery. Membrána nesmí uschnout!
44 Ekotech: Kurz základních metod molekulární biologie: Seznam a příprava chemikálií SEZNAM A PŘÍPRAVA CHEMIKÁLIÍ
Antifade
- 0,233g DABCO (1,4-diazobiocyclo (2.2.2.) Octan, Sigma)
- 800 μl miliQ H2O
- 200 μl 1M Tris-HCl, pH 8,0
- 9 ml glycerol (Merk, No. 1-12011, water-free)
store at +4°C
Biotinylated antistreptavidin (Vector, No. BA-0500, bought from Camon, Wiesbaden)
- reconstitution in 1 ml of miliQ water , add 0,6 ml of glycerol
- aliquot and store at –20°C
Blocking solution (BSA - Biomol, Albumine, bovine, Fraction V)
2,5% BSA in 4xSSC (5g BSA/40ml 20x SSC + 160 ml miliQ H2O)
- incubate for 5 hours in 4oC, then filter by 0,45 m "pore filter"
- aliquot and store at –20°C
DAPI (Diamidino-2-Phenylindole, Sigma No. D9542)
- 1mg/5ml miliQ H2O
store in dark at +4°C
50x Denhardt's reagens
- 2,5g Ficol (400, Pharmacia)
- 2,5g Polyvinylpyrolidon
- 2,5g BSA (Pentax fraction V - Gebra BSA H1)
- fill to volume 250ml by miliQ H2O
- filter by 0,45 m "pore filter"
- do not autoclave
- aliquot and store at –20°C
Dextran sulphate (Serva No.18705)
20% in 4xSSC
- 20g Dextran sulphate / 100ml 4xSSC (4xSSC prepare of 20x SSC, pH 7.0)
- dilute in 70°C in water bath, vortex and aliquot
- aliquot and store at –20°C
0,5M EDTA (pH 8) (100ml)
18,61g Na2EDTA + 2gNaOH, dilute in 80 ml miliQ H2O
- adjust to pH 8,0
- fill up with miliQ water to volume 100ml
- autoclave and store in room temperatute
Ethidium bromide
stock solution c=10mg/ml
final concentration for gel staining 0,5ug/ml, e.g. 5ul/100ml destiled H2O
45
Ekotech: Kurz základních metod molekulární biologie: Seznam a příprava chemikálií Loading buffer with EDTA
Bromfenol blue (0,05% w/v)
Sucrose 40%w/v
EDTA 0,1M, pH 8
SDS 0,5w/v
Na-acetate (3M)
408,1g Na-acetate dilute in 800ml miliQ H2O,
- adjust to pH 5,2 by cold acetic acid
- fill up to volume 1 liter
1x PBS buffer
miliQ H2O
0,15M NaCl
KCl
KH2PO4
0,05M Na2HPO4.12H2O
1 liter
8,0g
0,2g
0,2g
2,3g
2 liters
3 liters
16,0g
24,0g
0,4g
0,6g
0,4g
0,6g
4,63g 6,9g
- dilute in 80% of final volume (e.g. in 800 ml or 1600 ml or 2400 ml)
- adjust to pH 7,3
- fill up o the final volume (e.g. to 1000 ml or 2000 ml or 3000 ml)
- filter (0,45 m "pore filter") and autoclave
- store at +4oC or room temperature
When PBS buffer is widely used, it is more comfortable to make 10x PBS by simple
multiplication of amounts of all components by 10 and dilute them in same volume of water.
10xPBS is then diluted to 1x before use.
Rnase A
10 mg/ml in 0,01M Na-acetate or in water
- 15 min boil and then slowly cool down to room temperatute
- adjust pH by addition of 0,1 volume of Tris HCl (pH 7.4)
- aliquote and store at –20°C
Note: Rnase A is a small protein, which can survive 100°C, unlike DNAses. This treatment
removes the posible traces of DNases from the Rnase solution.
Streptavidin conjugted with Cy 3 (Jackson Research Laboratories, No. 016-160-084)
- reconstitute in 0.6 ml of miliQ water, add 0.6 ml of glycerol
- aliquote and store at –20°C
10% SDS (Sodium dodecyl sulphate)
- 100g SDS dilute in 900 ml autoclaved miliQ H2O at 68oC
- adjust pH to 7.2 by several drops of concentrated HCl
- fill up to volume 1 liter
Be carefull during weighing SDS, breathing in the crystals of SDS can be harmfull.
46
Ekotech: Kurz základních metod molekulární biologie: Seznam a příprava chemikálií 20x SSC pufr
miliQ H2O
3M NaCl
0,3M sodium citrate (C6H5O7Na3 . 2H2O)
1liter
175,32g
88,23g
2 liters
350,64
176,46g
3 liters
525,96g
264,69g
- dilute in 80% of final volume (e.g. in 800 ml or 1600 ml or 2400 ml)
- adjust to pH 7.0
- fill up o the final volume (e.g. to 1000 ml or 2000 ml or 3000 ml)
- filter (0,45 m "pore filter") and autoclave
- store at +4oC or room temperature
50x TAE buffer for elfectrophoresis
242g Trizma Base + 57,1 ml cold acetic acid + 100ml EDTA (pH 8)
- fill up to volume 1 liter.
- store at +4°C
For eletrophoresis and making electrophoretic gels the TAE buffer has to be diluted to 1x.
TE buffer
0,01M Tris HCl, 0,001M EDTA (pH 8,0)
Stock: 100x TE buffer:
88,8g Tris HCl
53g Trizma Base
37,2 g EDTA
dilute in 800 ml of water, adjust to pH 8.0 and fill up to 1 liter. Store at +4°C.
Before use the 100x TE buffer has to be diluted to 1x TE.
1M Tris-HCl (pH 8) (500ml)
44,4g Trizma HCl + 26,5g Trizma Base dilute in 400 ml miliQ H2O
- adjust to pH 8,0 (by 1M NaOH or 1M HCl)
- fill up by miliQ water to volume 500 ml
- autoclave and store at room temperature
0,01M Tris-HCl (pH 8) (500ml)
- dilute 1M Tris-HCl 100x
1M Trizma Base (500ml)
60,5g Trizma dilute in miliQ H2O and fill up to volume 500 ml
- autoclave
- store at room temperature
1M Tris-HCl (pH8)
8,88g Trizma HCl + 5,3g Trizma HCl dilute in 80ml miliQ H2O
- adjust to pH8 by 1M HCl
- fill up to volume 100ml
47

Podobné dokumenty

Text práce ve formátu PDF

Text práce ve formátu PDF axostyl tvořen mikrotubuly. V jeho okolí se nachází množství granulí se zásobními polysacharidy. Jádro je oválného tvaru a obsahuje kulovitý jadérko. (Kulda a Nohýnková 1978).

Více

návody na cvičení

návody na cvičení Na kvalitativní analýzu modelové směsi použijeme komerčně dostupné destičky pro tenkovrstvou chromatografii s chromatografickou vrstvou tvořenou silikagelem (SiO2). Složení vzorku určíme na základě...

Více

STANOVENÍ JASMONOVÉ KYSELINY V BIOLOGICKÉM MATERIÁLU

STANOVENÍ JASMONOVÉ KYSELINY V BIOLOGICKÉM MATERIÁLU Odebrané listy (cca 50 mg, 34 listy) byly hluboce zmraženy tekutým dusíkem, uloženy k dlouhodobému skladování při teplotě –70 °C a postupně purifikovány pomocí dvou postupů extrakce a purifikace p...

Více

návody do cvičení

návody do cvičení získané DNA přibližně vypočítat podle vztahu: cDNA (µg/ml) = 62.9 * A260 – 36.0 * A280 Do 1 cm křemenné kyvety napipetujeme vhodně zředěnou izolovanou DNA (10100x). Na stanovení koncentrace spotřeb...

Více

2010 - Moderní biofyzikální přístupy v experimentální biologii

2010 - Moderní biofyzikální přístupy v experimentální biologii 6. Otáčením okuláru o 90° lze pak stejným způsobem odečíst šířku buňky. 7. Proměříme větší počet buněk a průměrné hodnoty v dílcích se pronásobí zjištěnou hodnotou dílku (H) pro určité zvětšení a v...

Více

Katalog produktů

Katalog produktů Skupina zámků Avex Suite vyrobena Opal Orthodontics a vylepšena Dr Richardem P. McLaughlinem přináší prokázanou preciznost a předvídatelné výsledky léčení. Nejprofesionálnější systém techniky rovné...

Více

protokol-izolace-genom-dna-z

protokol-izolace-genom-dna-z zkumavky se 70% etanolem. Roztok centrifugujeme 10 min při 13 000 rpm. Pokud je koncentrace DNA v roztoku nízká a vlákna DNA tím nejsou okem patrná, je třeba roztok DNA centrifugovat (13 000 rpm, 2...

Více