Anguillula dipsaci
Transkript
Anguillula dipsaci
Czech University of Life Sciences, Department of Plant Protection, Prague, Czech Republic Figures, texts and tables used in this presentation are available on public web pages. Presentation can be used just for education, not for commercial purpose. •Digestive organs •Reproductiv e organs •Excretory structures •Muscles •Nerves •Tough skin or “Cuticle” 1. 2. 3. 4. 5. 6. 7. Most numerous animal Second most numerous species Size: mostly microscopic Simple morphology No circulatory system No respiratory system No skeleton Economic important microscopic non segmenting worms that live in different environment and feed roots. Nematodes can stunt the growth of the plants, and transmit pathogens as a virus, bacteria or fungy. Taxonomy of plant parasitic nematodes is rather complicated, many of nematologists described thousands of nematodes species during last hundred years. At the present time Siddigi 1986 is acceptable, with small number of correction especially for small groups of plant parasitic nematodes. Plant nematodes have both common and scientific names, some of economical importance, by common name, are: Root-knot, Sting, Stubby-root, Reniform, Lance, Ring, Lesion, Burrowing, Citrus, Spiral, and Cyst Most of the Plant Parasitic Nematodes we can decide into two classes and three orders. Most of plant parasitic nematode species belong to order Tylenchida. Virus vector nematodes are situated in orders Dorylaimida and Triplonchida. Order 1 Order 2 Order 3 Basic morphology and anatomy The nematode body is cover by cuticle which contain several layers depend on stage. The cuticle is the flexible coating around the nematode [its skin], which protects the nematode from physical and chemical dangers. The most noticeable feature of the cuticle is the system of grooves across the body from head to tail. As nematodes grow they usually shed their cuticle four times. The stylet is a hard, sharp spear used for feeding. Muscles move the stylet in and out and allow the nematode to puncture plant cells. Stylet (spear) penetrate cells inject coctail of enzymes and withdraw the contents of the cell. Form of the stylet is the important diagnostic criterion. The esophagus is a tube where food moves from the head to the intestine/stomach. Glands empty their contents into the esophagus to help digestion. The median bulb is a circular muscle which pumps food through the esophagus. In the center of the median bulb is a valve which only allows contents to move from the stylet to the intestine. The largest glands in nematodes are the esophageal glands. These glands are made of large cells with large nuclei and are thought to release substances which help with digestion and feeding. Nematode digestive systems are made of a tube of a single layer of cells - the intestine. Food enters the intestine from the esophagus, nutrients are absorbed, and wastes are released through the anus. Excretory System Simple tubular system - in one or both lateral hypodermal chords in Secernentea; embedded between the three cell bodies in hypodermal chord. Individual excretory cells or tubular system in Adenophorea. Excretory pore (external opening of tubular excretory systems) usually visible due to cuticular lining - ventral, position is diagnostic. Reproduction Most nematode species produce males and females, but some species only produce females. The ovary is where germ cells give rise to eggs. Fertilization, by the sperm, takes place in the uterus and eggs are released through the vagina. Even though the size of nematodes varies greatly, most nematode eggs are about the same size and shape. Male nematodes produce sperm in the testes which are shaped similar to the female ovary. Sperm accumulate in the seminal vesicle and exit through the anus. During mating rigid spicules insert into the vagina and form a passageway for the sperm. Some males have thin cuticle extensions on both sides of the anus called bursae copulatrix. Spiule form is the most important diagnostic criterion. Neural system The nerve ring is the largest group of nerve cells in nematodes. Six bundles of nerve cells extend from the nerve ring to sensory receptors in the nematode head. Other nerve cells extend from the nerve ring towards the tail. In Plant parasitic group of nematodes s usually visible just nerval ring. Nematodes have a variety of sensilla: (i) Amphids open on or below lips (position of opening is diagnostic). pouch with sensory neuron. opening is a pore, slit, spiral, etc. seem to contain mucoid material. probably function a chemoreceptor's. (ii) Phasmids posterior location in lateral field - (chemoreceptors). occur in Secernentea but not Adenophorea. scutella are enlarged phasmids in some genera of Tylenchida (e.g., Scutellonema). (iii) Other Sensilla have a fairly consistent structure; they include: elongate setae sensory pegs shallow pits deeper pits (e.g., amphids) cephalic papillae - on lips - (tactile function?) cephalic setae - more elongate somatic setae - rare in Secernentea, but occur in Adenophorea deirids - in lateral field near nerve ring (chemoreceptor's?) Nematodes may be grouped by feeding habit as: •Endoparasitic– entire body inside the root •Ectoparasitic– entire body outside the root •Semi-endoparasitic- part of body inside root By movement when feeding, they are called: •Sedentary – mostly immobile during their life •Migratory – mobile for all their life. Frequent life cycle (example on Heteroderidae family) Sampling representative Plant material soil samples Extraction methods Imobile stages (sedentery nematodes) cysts in the soil Mobile stages (free living nematodes) females in the roots Flotation methods Strip paper method Fenvick can Thomas can Oostenbrick elutriator Navlhčit a vložit papír Vzorek půdy Zalít vodou Přidat detergent Krátce zamíchat Nechat 5 min stát Baerman funel Umělohmotné sítko Skleněná nálevka Silikonová hadice tlačka ED miska Sieving method Symptomatic methods use in nematology Light microscopy Electron microscopy Immunochemical methods Molecular biology methods Symptomatic methods use in nematology bulb scab circular focus of the infection knoting and swelling forest dieback dwarfism sweling necrosis Light microscopy Nativ slides x fixed slides fixed nematodes Measurement of nematodes L – body lenght a – ratio of body lenght (L): width of body b – L: distance of mouth from intestine and oesophaus conection c – L: tail lenght Měření háďátek V= distance between moth and vulva L x 100 : Měření háďátek T= distance between anteriar intestine part and cloaca L x 100 : Electron microscopy Immunochemical methods Molecular biology methods PCR RAPD RFLP SSCP SCAR AFLP RTPCR DBH real time PCR Plant protection against to nematodes •Observance of the rules of Quarantine status •Clean tools and equipment when changing areas or fields •Crop rotation •Chemical treatments nematicides •Nematode-free (certified) seeds and planting material •Tolerant or resistant cultivars (GMO?) •Soil solarization •Biofumigation •Biological control •Plant extracts application •Ozone irrigation The interactions of many soil organisms results in biological buffering or regulation of the nematode population through the mechanisms of Exploitation, Competition, and Antibiosis. This mechanisms can be use for nematode regulation. Nematode antagonist FUNGY nad batteries. Arthrobotrys botryospora, Arthrobotrys superba, Dactylaria psychrophila, Dactylaria candida, Dactylaria lysipaga, Dactylella sp., Arthrobotrytis sp, Catenaria auxiliaris, Nematophthora gynophila. Bacteries Egg parsites Application of plant extracts and essences Azadirachta indiga Globodera rostochiensis Globodera pallida Oblast vulvy CBH Interpretace výsledků Protilátka Mab 1rp je schopna konjugovat s antigenem získaným z Ro i Pa. Naproti tomu protilátka Mab 2p reaguje pouze s antigenem získaným z Pa. kontrola Mab 1rp Globodera pallida Mab 2p Mab 1rp Globodera rostochiensis Mab 2p Multiplex PCR rozlišení Ro, Pa M - molekulární marker 1 - DNA extrahovaná z Pa1 2 - DNA extrahovaná z Pa2 3 - DNA extrahovaná z Pa3 4 - DNA extrahovaná ze směsné populace Ro a Pa 5 - DNA extrahovaná z Ro1 6 - DNA extrahovaná z Ro2/3 7 - DNA extrahovaná z Ro4 8 - DNA extrahovaná z Ro5 M - molekulární marker 1, 3, 5, 7, 9 - DNA extrahovaná z Ro1 2, 4, 6, 8, 10 - DNA extrahovaná z Pa2 M - Molekulární marker 1 - 4 - DNA získaná vždy z jednoho embryonu Pa Ditylenchus dipsaci was described by (Kuhn, 1857) Filipjev, 1936 as a Bulb and Stem Nematode Taxonomic position CLASS: SECERNENTEA •SUBCLASS: DIPLOGASTERIA •ORDER: TYLENCHIDA •SUBORDER: TYLENCHINA •SUPERFAMILY: TYLENCHOIDEA •FAMILY:ANGUINIDAE Common names: ENG: Stem nematode, stem and bulb eelworm, onion bloat IT: Nematode dello stelo e dei bulbi Host races are morphologically indistinguishable with different host preferences. Synonyms Anguillula dipsaci Kuhn, 1857 Anguillula dipsaci (Kuhn) Gerv. et. v. Ben., 1859 Tylenchus dipsaci (Kuhn) Bastian, 1865 Anguillula devastatrix Kuhn, 1868 Anguillula secale Nitschke, 1868 Anguillula putrefaciens Kuhn, 1877 Tylenchus havensteini Kuhn, 1881 Tylenchus hyacinthi Prillieux, 1881 Tylenchus alii Beijerinck, 1883 Tylenchus devastatrix Ritzema Bos, 1888 Ditylenchus phloxidis Kirianova, 1951 Ditylenchus fragariae Kirianova, 1951 Anguillula dipsaci var. dipsaci Steiner and Scott, 1935 Anguillula dipsaci var. communis Steiner and Scott, 1935 GEOGRAPHICAL DISTRIBUTION D. dipsaci occurs locally in most temperate areas of the world (Europe and the Mediterranean region, North and South America, northern and southern Africa, Asia and Oceania) but it does not seem able to establish itself in tropical regions except at higher altitudes that have a temperate climate. In most countries regulatory measures (e.g. certification schemes) are applied to minimize further spread of D. dipsaci. EPPO region: Albania, Algeria, Austria, Belarus, Belgium, Bulgaria, Croatia, Cyprus (unconfirmed), Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Israel, Italy, Latvia, Liechtenstein, Malta, Moldova, Morocco, Netherlands, Norway, Poland, Portugal, Romania, Russia (European), Slovakia, Spain, Sweden, Switzerland, Syria, Turkey, Tunisia, UK, Ukraine, Yugoslavia. BIOLOGY D. dipsaci is a migratory endoparasite that feeds upon parenchymatous tissue in stems and bulbs, causing the breakdown of the middle lamellae of cell walls. Feeding often causes swellings and distortion of aerial plant parts (stems, leaves, flowers) and necrosis or rotting of stem bases, bulbs, tubers and rhizomes. During cold storage of bulbs and tubers, D. dipsaci and rotting may continue to develop. In onion plants at 15°C, the life-cycle takes about 20 days. Females lay 200 to 500 eggs each. Fourth-stage juveniles tend to aggregate on or just below the surface of heavily infested tissue to form clumps of "eelworm wool" and can survive in a dry condition for several years; they may also become attached to the seeds of host plants (e.g. onions, lucerne, Trifolium pratense, faba beans, Phlox drummondii). In clay soils, D. dipsaci may persist for many years. Cool, moist conditions favour invasion of young plant tissue by this nematode. Over 450 hosts complicated by there being 8-10 host races or biotypes, some with limited host range. Oat race: polyphagous, most grains, rye, corn, and oats. Alfalfa race: rather specific, but alfalfa, many weeds, clovers. Bulb race: most bulbs, daffodil, narcissus, and tulip. Other hosts include onion, garlic, carrots, peas, potatoes, strawberry, sugarbeets; apples and peaches in nurseries; weeds. DETECTION AND IDENTIFICATION Symptoms In general, this nematode causes swellings and distortion of aerial plant parts and necrosis or rotting of stem bases, bulbs, tubers and rhizomes. Morphology Slender transparent worms; adult about 1.2 mm long head skeleton moderately developed, spear about 10-12 µm long with distinct basal knobs. Female: 1.0-1.3 mm; a = 36-40; b = 6.5-7.1; c = 14-18; V = 80 tail terminus sharply pointed. Post-vulval sac extending about half-way to the anus. Male: 1.0-1.3 mm; a = 37-41; b = 6.5-7.3; c = 11-15; T = 65-72 Bursa rising opposite proximal ends of spicula and extending about threefourths the length of the tail. Specific detection of D. dipsaci in tissue 18 S ITS 1 5,8S ITS 2 28 S S21 S 18 900 bp Fig. 1: Scheme of cistron rDNA and localization of used primersfor amplification of fragment between cistrons genes. 5 -AACGGCTCTGTTGGCTTCTAT-3 PF1 5 -ATTTACGACCCTGAGCCAGAT-3 PR1 5 -TCGCGAGAATCAATGAGTACC-3 PF2 5 -AATAGCCAGTCGATTCCGTCT-3 PR2 Fig. 4. Gel electrophoresis of the PCR products obtained with primer pairs PF1-PR1, using as template DNA extracted from plant tissue artificially infested with 15 individuals of D. dipsaci (A), or healthy plant tissue (B). Lanes: 1 – garlic bulb, 2 – onion bulb, 3 – chicory petiole, 4 – alfalfa stem, 5 – carrot bulb, 6 – positive control with genomic DNA of D. dipsaci, 7 – negative control of sterile distilled water, lanes M – MassRuler 100 bp DNA ladder (Fermentas, Lithuania) Fig. 3. Agarose gel of the PCR products using specific primer pairs PF1-PR1 (A) and PF2-PR2 (B). Lanes: 1,2 and 3 – D. dipsaci (isolates from garlic, chicory and alfalfa), 4 – G. pallida, 5 – B. xylophilus, 6 – Rhabditis spp., 7 – negative control of sterile distilled water, M – MassRuler 100 bp DNA ladder (Fermentas, Lithuania). A fragment of 327 bp for PF1-PR1 primer pair and 396 bp for PF2-PR2 primer pair bp are observed with all isolates of D. dipsaci, while no fragment was amplified with other nematodes Analysis of ITS sequences of nuclear rDNA and development of a PCRbased assay for the rapid identification of the stem nematode Ditylenchus dipsaci (Nematoda: Anguinidae) in plant tissues M. Marek, M. Zouhar, P. RyŠánek, P. Havránek1 Fig. 5. Gel electrophoresis of the PCR products obtained with primer pairs PF1-PR1 (A) and PF2-PR2 (B), using tenfold dilution series of DNA template. Lanes: 1 to 6, 100 ng to 1 pg of D. dipsaci genomic DNA, 7 – negative control of sterile distilled water lanes M – MassRuler 100 bp DNA ladder (Fermentas, Lithuania). The detection threshold is observed to be 10 pg for PF1-PR1 primer pair and 100 pg for PF2-PR2 primer pair Department of Plant Protection, Czech University of Agriculture in Prague, Kamýcká 129, 165 21 Prague 6, E-mail: [email protected]; 1Kosmonautů 1029/9, 772 00 Olomouc, Czech Republic Accepted for printing 2005 Meloidogyne sp. ROOT KNOT NEMATODE Populace získané v zahraničí Meloidogyne incognita Meloidogyne hapla Meloidogyne chitwoodi Meloidogyne fallax Meloidogyne arenaria Meloidogyne javanica Anglie (M. Philips) Portugalsko (University of Evora) Egypt Skotsko (SCRI Dundee) Košice (SAV) Nizozemí (PRI Wageningen) Nizozemí (PRI Wageningen) Anglie (M. Philips) Anglie (M. Philips) Optimalizace metody PCR 1. Diagnostika háďátka Meloidogyne incognita Primery byly navrženy ze sekvence DNA kódující esophageal gland protein SEC-1 a byly pojmenovány MIGF a MIGR. Primery: MIGF 5´- GGGCAAGTAAGGATGCTCTG –3´ %GC 55,00 MIGR 5´-GCACCTCTTTCATAGCCACG –3´ %GC 55,00 M – molekulární marker 1 – DNA extrahovaná C. Zijstrou 2 – DNA extrahovaná našimi primery M – molekulární marker 1 – DNA extrahovaná z 10 samiček 2 – DNA extrahovaná z konatminované půdy M – molekulární marker 1 – DNA extrahovaná z M. incognita 2 – DNA extrahovaná z M. incognita 3 – DNA extrahovaná z M. javanica 4 – DNA extrahovaná z M. arenaria 5 – DNA extrahovaná z M. chitwoodi 6 – DNA extrahovaná z M. hapla 7 – DNA extrahovaná z M. fallax M – molekulární marker 1 – DNA extrahovaná z jedné samičky 2 – DNA extrahovaná z kořenových hálek 3 – DNA extrahovaná z půdy 4 – DNA extrahovaná ze zárodečných vaků 2. Diagnostika háďátek rodu Meloidogyne pomocí Multiplex PCR Jako výchozí práce pro optimalizaci Multiplex PCR reakce byla použita publikace C. Zijlstra et al., 1997. Reversní primer HCFI – 28S byl popsán Ferrisem et al., 1993. Primery: CF – ITS 5´- GAATTATACGCACAATT – 3´ H – 18S 5´- CTTGGAGACTGTTGATC -3´ I –ITS 5´- TGTAGGAGACTGTTGATG -3´ HCFI – 28S 5´- GCATATCAGTAAGCGGAGGAA -3´ (jako reverzní univerzální primer) M – molekulární marker 1 – DNA extrahovaná z M. hapla 2 – DNA extrahovaná z M. fallax 3 – DNA extrahovaná z M. chitwoodi 4 – DNA extrahovaná z M. incognita 3. Diagnostika háďátek M. hapla a M. chitwoodi Byla optimalizována metoda pro odlišení M. hapla a M. chitwoodi. Byly použity tyto primery: MHOF 5´-CAGGCCCTTCCACCTAAAGA- 3´ MHIR 5´- CTTTCGTTGGGGAACTGAACA- 3´ MCIR 5´- CCAATGATAGAGATAGGCAC -3´ MC3F 5´- CTGGCTTCCTCTTGTCCAAA – 3´ M – molekulární marker 1 – DNA extrahovaná z M. chitwoodi 2 – DNA extrahovaná z M. hapla http://mgd.nacse.org/hyperSQL/squiggles/songs.html