genové čipy

Komentáře

Transkript

genové čipy
15/03/2010
genové čipy
co to je genový čip (DNA microarray)?
DNA šikování
•
•
•
nová technologie zavedená koncem devadesátých let
geny nebo fragmenty genů (cDNA, EST) jsou roboticky v přesně daných
souřadnicích umístěny na mikroskopické sklo (plast)
takto vytvořený genový čip se hybridizuje s RNA nebo cDNA určitého
vzorku a následně počítačově srovná se standardem
Northern Blot
imobilizována mRNA se
hybridizuje se značenou probou
reprezentující jeden gen
DNA Microarray
imobilizované proby hybridizují
se značenou mRNA reprezentující
všechny exprimované geny
1
15/03/2010
princip genových čipů
• do jednoho čipu lze uložit informaci celého genomu (až 50.000)
• komerčně připravované čipy se prodávají pro celé organismy, které
mají odsekvencovaný genom
• u vlastních microarray se používají jen krátké oligonukleotidy
reprezentující
p
j
jjednotlivé ggenyy o známe funkci a všechnyy další EST
získané z daného organismu
• velice náročná příprava (imobilizace desetitisíců prób na velmi
malé ploše
•
následuje označení
srovnávaných populací mRNA
většinou fluorescenčně
•
p
promytí
y takto označené mRNA
čipem
•
vyhodnocení rozdílů – je
není exprimovaný
•
u nejmodernějších i jak moc
•
vše je řízeno počítačově
Human ~ 30,000 genes
Mouse ~ 30,000 genes
Yeast ~ 6200 genes
E. coli ~ 4200 genes
Phage T4 ~ 200 genes
Influenza ~ 12 genes
Macroarray & Microarray
& DNA Chips
Micro a macroarray: lepené
Próby [0.6 kb - 2.4 kb] jsou
PCR amplifikované celé cDNA
nebo EST [expressed sequence
tags] sekvence.
Jsou roztříděny a přilepeny
roboticky na nepórozní pevný
nosič (plast).
macroarray 1000 skvrn
microarray 10000 skvrn.
DNA čipy: syntetizované umělé
(Affymetrix technologie)
Próby jsou 20-25 deoxyoligonucleotidy syntetizované na sklo speciální
technikou (fotolitografie) Komerční
čipy mají 300.000 prób na 3 cm2
Experimentální čipy i s miliónem
prób na array.
2
15/03/2010
práce s genovým čipem
Affymetrix technologie
1.28cm
50um
3
15/03/2010
fotolitografie
metoda pro syntézu Affymetrix čipů
• wafer (křemíková destička se předem promyje a aktivuje (reakční
hydroxylové skupiny)
• ponoří se do silanu který zajistí jednolitou rovnoměrnou vrstvu
• ta se překryje maskou která je řízená počítačem a na přesně daných
místech se ppak světlem aktivuje
j
hydroxy
y
y skupina
p
na kterou se
syntetizuje přesně určený nukleotid (podle databáze)
• opět se překryje vrstvou silanu a maskou
• maska se přesune a opět aktivuje světlem
• a opakuje se 25x
• syntéza 25-oligonukleotidu
• na jeden gen několik prób
Affymetrix technologie
• každé místo próby je obsazeno 22 oligonukleotidy reprezentující
jeden gen
• 11 z nich je tzv.perfect match (PM) přesně kopírují sekvenci genu
• 11 z nich je mismatch (MM) liší se jedním nukleotidem v centrální
pozici (12-1-12)
• např. U133A human array, obsahuje přes 22.000 různých sekvencí
(genů) které jsou reprezentovány zhruba v 500.000 oligonukleotidech
4
15/03/2010
Affymetrix GeneChips
referenční sekvence genu
5’
3’
vzorek mRNA
vymezení DNA próby
pairs
…TGTGATGGTGGGAATGGGTCAGAAGGGACTCCTATGTGGGTGACGAGGCC…
TTACCCAGTCTTCCCTGAGGATACAC
Perfect match oligo
TTACCCAGTCTTGCCTGAGGATACAC
Mismatch oligo
Probe Set
PM
MM
PM
Probe Pair
PM
Probe Cell
MM
PM - 25 bazí komplementárních k referenční sekvenci
MM – prostřední báze je odlišná
Affymetrix technologie
značení mRNA populace
Cy3-dCTP
Cy5-dCTP
5
15/03/2010
Affymetrix technologie
značení mRNA populace
cy3 and cy5: běžně používané fluorescenční značky
cy5
664 nm
emission
cy3
510 nm
cy5
yellow cy3=cy5
emission red cy5>cy3
green cy3>cy5
cy3
www.amersham.com
6
15/03/2010
Affymetrix technologie
Affymetrix technologie
Agilent bioanalyzer
7
15/03/2010
Affymetrix technologie
po promytí dvěma různýma
populacemi mRNA se zeleným a
červeným značením je celá array
skenována a vyhodnocena ve
speciálních programech
nejdřív se vyhodnotí rozdíl mezi
PM a MM (tím se velmi redukuje
chyba)
MM próby vychytávají nespecifický
signál
následně se srovnají vzájemně
i t
intenzity
it
v ideálním případě by dvě
naprosto totožné populace mRNA
dávali celou žlutou array
PM
MM
Affymetrix technologie
8
15/03/2010
Affymetrix technologie
PG2
• tento komerční genový čip obsahuje 5 arrayi
• Array B,C,D,E obsahují 4x cca 12.000 prób pro
klustry komprimované z lidských EST klonů
• array A obsahuje
b h j cca 12
12.000
000 prób
ób pro lidské
lid ké geny
o známé funkci
• tento čip obsahuje genetickou informaci ze dvou organismů
Saccharomyces cerevisiae a Schizosaccharomyces pombe
• čip obsahuje próby pro 5,841
5 841 z 55,845
845 všech genů přítomných v
S.cerevisiae a 5,021 z 5,031 genů přítomných v S. pombe.
• divergence mezi oběma kvasinkami proběhla zhruba před 500 milióny lety
a proto je mezi nimi taková odlišnost, která vyžaduje samostatné
próby.
• informace z obou genomů je ale uložena pouze v jednom arrayi.
• Sekvence pro navržení prób byly vygenerovány z veřejných databázi
GenBank® (květen 2004) a Sanger Center (červen 2004)
9
Snímek 18
PG2
S. cerevisiae has approximately 5600 open reading frames; S. pombe has approximately 4970 open
reading frames.
S. cerevisiae has 16 chromosomes, S. pombe has 3.
S. cerevisiae is often diploid while S. pombe is usually haploid.
Both species share genes with higher eukaryotes that they do not share with each other. S. pombe
has heterochromatin and RNAi machinery genes like those in vertebrates, while these are missing
from S. cerevisiae. Conversely, S. cerevisiae has well developed peroxisomes, while Sch. pombe does
not.
galuszka; 19/03/2009
15/03/2010
další typ genového čipu
jednotlivé array jsou rozděleny podle orgánu ze kterého byl získán
daný EST
Lung
20,224
Liver
37,807
P
Prostate
t t
7,971
Skin
3,043
Brain
67,679
Brain
Lung
Heart
9,400
Colon
4,832
Liver
Liver Tumor
Bone
4,832
• vznikají i čipy pro organismy, které nemají
odsekvenovaný genom
• např. Affymetrix čip pro ječmen (srpen 2004)
• přes 22.500 prób
• z toho 1.145 známých genů (včetně alel)
• z databázi bylo extrahováno zhruba 400.000
ječmenných EST klonů, ty byly počítačově
zpracovány a bylo vytvořeno 26.634
26 634 kontigů a
24.396 singletonů
• všechny tři zdroje byly znova zpracovány a bylo
vybráno 22.500 jedinečných genů či jejich
fragmentů s kompaktním 3´koncem pro vytvoření
prób
Potencionální využití
studium
t di kkvality
lit sladu,
l d
kontrola proti škůdcům a
nemocem, abiotický stres,
nutriční charakteristika
10
15/03/2010
cena
největší problém
(2OO2)
využžití genových čip
vyu
ipů
ů
•
•
•
•
•
Studium exprese genů (regulace genů)
Funkce nových genů (neobjevené metabolické pochody)
Detekce mutantů
Diagnóza nemocí(analýza polymorfismu)
Hl dání nových
Hledání
n ý h léčebných
léč bný h postupů
p tupů (jestli
(j
li určitý
či ý
ddruh
h
rakoviny zvyšuje expresi daných genů, můžeme zjistit které další
podmínky způsobují expresi těchto genů a případně zjistit, která
látka ji zpětně snižuje - potenciální lék)
• Farmakogenomika (testování nových léčiv před uvedením na trh)
• Toxikogenomika (hledání korelace mezi odpovědi na toxickou
látku a změny jí vyvolané v genetickém profilu)
11
15/03/2010
studium expres
expresee gen
genů
ů
ZMĚNY V EXPRESI GENů VYVOLANÉ KOUŘENÍM
transcriptony z buňek plicního epitelu nekuřáků, kuřáků, bývalých kuřáků a kuřáku různých
ras a věku byly izolovány a podstoupeny hybridizaci z GeneChip® U133A
NEKUŘÁCI
• Bylo zjištěno že v jejich buňkách se exprimuje cca 2,000 genů
• Exprese těchto genů není ovlivněna věkem, rasou ani pohlavím
• Většina genů tvoří geny spojené z oxidativním stresem, ion/elektronové přenašeče,
chaperony, vezikulární transportery atd.
.
KUŘÁCI
.
• Zvýšená exprese 97 genů – spojené s buněčnou adhezí, oxidativním stresem,
metabolismem gluthationu, transportem elektronů, metabolismem a sekrecí xenobiotik a
několik onkogenů
• Downregulovány byly supresory tumorů a zánětové regulátory.
• Profil tři dlouhodobých kuřáků stejný jako u nekuřáku !!!
• Profil daleko výraznější u starších kuřáků
• Pohlaví nemá vliv, rasa ano
• Kavkazská rasa daleko slabší profil než negroidní
BÝVALI KUŘÁCI
• Návrat k normální expresi do dvou let
• Stále vysoká hladina supresorů tumorů a některých onkogenů
.
VÝZNAM
.
• Objeveno spousta genů které nebyly s kouřením spojovány (metabolismus gluthationu)
• Dají se identifikovat kuřáci s vysokým rizikem ke vzniku rakoviny plic
12
15/03/2010
• pro diagnostické účely se budou používat čipy s limitovaným počtem
prób (metoda bude daleko levnější)- prediktivní medicína
• Affymetrix technologie je značně spolehlivá (při testování 34
stejných vzorků byla 94-97% shoda).
• DNA bi
biočipy
či jjsou považovány
ž á za nejobjevnější
j bj
ější genetický
ti ký nástroj
á t j
poslední dekády
PROBLÉMY GENOVÝCH ČIP
IPů
ů:
• znalost sekvence genu a míry její exprese mnohdy nestačí k
předpovězeni povahy a množství proteinu jí kódovaného
(mno
množžství
mRNA není vž
vždy úměrné množ
množství proteinu)
proteinu
• alternativní splicing – jeden gen produkuje více proteinů
• syntéza proteinů je ovlivněna i vnějšími vlivy a může se lišit i v
čase
• význam proteomiky
13
15/03/2010
obrana proti bioterorismu
biologická válečná agens jsou bez barvy a bez zápachu a většinou trvá dny
až týdny než vyvolají symptomy
obrana proti bioterorismu
• nejnovější detektory biologických zbraní dokážou odlišit patogeny od
neškodných organismů tím,že srovnávají jejich genetickou výbavu
• systém GeneXpert nebo(americká firma Cepheid)
• obsahuje koncentrátor vzduchu a filtr zachycující patogeny
• dezintegrátor buněk
• DNA patogenů pak jde do speciálního čipu obsahující ssDNA ze všech možných
pathogenů, který má po stranách elektrody
• čip se pak hybridizuje s krátkými komplementárními próbami značenými
zlatými částečkami
• pokud dojde k hybridizaci sepne se
pomocí zlatých částeček obvod
• jiný typ detektoru je založen na
real-time
l ti PCR
• databáze TIGER triangulační genetická
evaluace biologických rizik
• amplifikace úseku genomu odpovědného za
proteosyntesu, nelze zneužít mutací patogena
14
15/03/2010
• Swiss Federal Institute for Technology
• sledování exprese 23,750 genů u modelové rostliny
Arabidopsis thaliana v jednotlivých orgánech a v
závislosti na ontogenezi, a biotických a abiotických
faktorech
• proč Arabidopsis?
• 25 498 genů zhruba u 60% je předpovězena nebo objasněná
funkce
• databáze zpracovává data z 2317 arrayí (listopad 2005)
15
15/03/2010
16

Podobné dokumenty